Rmu_sc0037241.1_g000002
MYB Family

response regulator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037241.1
OG0017706
Physical Location & Seq
Forward (+)
14035 .. 15385
1351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037241.1_g000002.1.cds

Sequence Viewer

Length: 1104 bp
atgaacgttgaaggcctgactagagaaaacgtggcgagccatttgcagaagtatagacaatttttaaggagagttgcagtaaagatttcagtaagtaaatcggatattggtaacaagtcccagacgtcaagctctacattcgggcaaagccaaacttcgatattccagcagcagcccatttctggacagaatctctccataaatcttattgcttcaagcctcggacgtcccctttttcgtgccaatcaccacgaagcgtcaaccacttccgtgcctccattcggaaacacatcacacttatatcaaccgaattctctatcacatttccagatgccgcaacctgctttcatggggtacccagggtctttccaaccagccaattacgcatcagttaatgggagtggatttcagacaaacaatgttcaaagcaattggtcaagtgctaatggactccaagctcaaacaagtccactgaccaaccacctatatggcaattacaataacgatggcatgagtacagggtttcagtttggttcatggaatggaactatgggatttctgaatgattctaataatctcatcaccaacaactactatggtggactcccaatgagtggtgctgcttctgtagggctagttggatttaactcgaatcaaaaccctaatttgatggtggcgaaatacggctgggcttcaacaactagtggactcgatactaatttttttggatcggttctgaatgatattgatcaaagtgagcttcatcaagaaatgaacaatacttcaccaacgggaaatttgatgttcggtaacaataaattttcaggcgtggaggatgcttcatcagttggttttggtggtattacaactgtggaagctgcggcttctagctctaatgttgtagacgtatcaccaaatcagaatcaaaccggcgagtactttgatgaacttgatgatatcttattcaacgataccaatttgcaatctgtcaaccaggaagaaggaaaagaagtggtcaatttttatgagattaatgcaaatgcggttcaagaaaatgcttccttgctcaaagaatccaacggccaggcatgtatctgtcactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Myb_DNA-binding Response_reg

Protein Analysis

367

Amino Acids

39.6

Weight (kDa)

4.89

Isoelectric Point (pI)

38.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017706)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g07970
malus_domestica MD02G1229600.v1.1
rosa_chinensis RchiOBHm_Chr1g0341321
rosa_multiflora Rmu_sc0000047.1_g000016 Rmu_sc0037241.1_g000002
rosa_roxburghii Rroxscaffold_4G00311970
rosa_rugosa Rorug01G0157400.1
rosa_samantha Rh1AG172200 Rh1BG140000 Rh1CG160300 Rh1DG172400
rosa_wichuraiana Rw1G014360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 128, 229
Acc36I ACCTGC 1 cut(s) 349
Acc65I GGTACC 1 cut(s) 354
AccB1I GGYRCC 1 cut(s) 354
AccB7I CCANNNNNTGG 1 cut(s) 614
AccI GTMKAC 1 cut(s) 903
AciI CCGC 3 cut(s) 335, 881, 1043
AclI AACGTT 1 cut(s) 6
AclWI GGATC 1 cut(s) 736
AcoI YGGCCR 1 cut(s) 1081
AcsI RAATTY 3 cut(s) 310, 796, 818
AcyI GRCGYC 2 cut(s) 125, 226
AfaI GTAC 3 cut(s) 356, 517, 938
AfiI CCNNNNNNNGG 3 cut(s) 182, 281, 614
AgsI TTSAA 6 cut(s) 11, 216, 425, 696, 967, 1049
AhlI ACTAGT 1 cut(s) 701
AjnI CCWGG 3 cut(s) 358, 993, 1083
AleI CACNNNNGTG 1 cut(s) 269
AluBI AGCT 5 cut(s) 132, 458, 760, 878, 891
AluI AGCT 5 cut(s) 132, 458, 760, 878, 891
AlwI GGATC 1 cut(s) 736
AoxI GGCC 2 cut(s) 13, 1081
ApeKI GCWGC 4 cut(s) 169, 172, 620, 878
ApoI RAATTY 3 cut(s) 310, 796, 818
AseI ATTAAT 1 cut(s) 1032
Asp718I GGTACC 1 cut(s) 354
AsuHPI GGTGA 4 cut(s) 239, 574, 777, 903
BanI GGYRCC 1 cut(s) 354
BbvI GCAGC 4 cut(s) 181, 184, 607, 865
BccI CCATC 2 cut(s) 500, 664
BceAI ACGGC 2 cut(s) 700, 1096
BcgI CGANNNNNNTGC 2 cut(s) 25, 59
BciT130I CCWGG 3 cut(s) 360, 995, 1085
BclI TGATCA 1 cut(s) 748
BcuI ACTAGT 1 cut(s) 701
BfaI CTAG 4 cut(s) 21, 635, 702, 888
BfmI CTRYAG 1 cut(s) 627
BfuAI ACCTGC 1 cut(s) 349
BisI GCNGC 6 cut(s) 170, 173, 335, 621, 879, 882
BlsI GCNGC 6 cut(s) 171, 174, 336, 622, 880, 883
BmcAI AGTACT 1 cut(s) 938
Bme1390I CCNGG 3 cut(s) 360, 995, 1085
BmiI GGNNCC 1 cut(s) 356
BmrFI CCNGG 3 cut(s) 360, 995, 1085
BmsI GCATC 3 cut(s) 321, 395, 826
BsaBI GATNNNNATC 1 cut(s) 747
BsaHI GRCGYC 2 cut(s) 125, 226
BsaJI CCNNGG 3 cut(s) 220, 358, 359
Bsc4I CCNNNNNNNGG 3 cut(s) 182, 281, 614
Bse118I RCCGGY 1 cut(s) 929
Bse8I GATNNNNATC 1 cut(s) 747
BseBI CCWGG 3 cut(s) 360, 995, 1085
BseDI CCNNGG 3 cut(s) 220, 358, 359
BseGI GGATG 1 cut(s) 841
BseJI GATNNNNATC 1 cut(s) 747
BseLI CCNNNNNNNGG 3 cut(s) 182, 281, 614
BseXI GCAGC 4 cut(s) 181, 184, 607, 865
BseYI CCCAGC 1 cut(s) 687
BshFI GGCC 2 cut(s) 15, 1083
BshNI GGYRCC 1 cut(s) 354
BsiSI CCGG 1 cut(s) 930
BslFI GGGAC 2 cut(s) 103, 213
BslI CCNNNNNNNGG 3 cut(s) 182, 281, 614
BsmFI GGGAC 2 cut(s) 103, 213
BsnI GGCC 2 cut(s) 15, 1083
Bsp143I GATC 2 cut(s) 728, 748
BspACI CCGC 3 cut(s) 335, 881, 1043
BspANI GGCC 2 cut(s) 15, 1083
BspLI GGNNCC 1 cut(s) 356
BspMI ACCTGC 1 cut(s) 349
BspPI GGATC 1 cut(s) 736
BspT107I GGYRCC 1 cut(s) 354
BsrFI RCCGGY 1 cut(s) 929
BssAI RCCGGY 1 cut(s) 929
BssECI CCNNGG 3 cut(s) 220, 358, 359
BssMI GATC 2 cut(s) 728, 748
BssNI GRCGYC 2 cut(s) 125, 226
Bst2UI CCWGG 3 cut(s) 360, 995, 1085
Bst4CI ACNGT 1 cut(s) 871
BstACI GRCGYC 2 cut(s) 125, 226
BstC8I GCNNGC 1 cut(s) 37
BstF5I GGATG 1 cut(s) 841
BstKTI GATC 2 cut(s) 731, 751
BstMBI GATC 2 cut(s) 728, 748
BstMWI GCNNNNNNNGC 1 cut(s) 383
BstNI CCWGG 3 cut(s) 360, 995, 1085
BstNSI RCATGY 1 cut(s) 1092
BstSCI CCNGG 3 cut(s) 358, 993, 1083
BstSFI CTRYAG 1 cut(s) 627
BstV1I GCAGC 4 cut(s) 181, 184, 607, 865
BstXI CCANNNNNNTGG 1 cut(s) 488
BsuRI GGCC 2 cut(s) 15, 1083
BtsCI GGATG 1 cut(s) 841
BtsIMutI CAGTG 2 cut(s) 470, 1099
BveI ACCTGC 1 cut(s) 349
Cac8I GCNNGC 1 cut(s) 37
Cfr10I RCCGGY 1 cut(s) 929
CseI GACGC 1 cut(s) 246
Csp6I GTAC 3 cut(s) 355, 516, 937
CviAII CATG 4 cut(s) 349, 511, 537, 1089
CviQI GTAC 3 cut(s) 355, 516, 937
DpnI GATC 2 cut(s) 730, 750
DpnII GATC 2 cut(s) 728, 748
EaeI YGGCCR 1 cut(s) 1081
Eco147I AGGCCT 1 cut(s) 15
Eco32I GATATC 1 cut(s) 958
EcoRI GAATTC 1 cut(s) 310
EcoRII CCWGG 3 cut(s) 358, 993, 1083
EcoRV GATATC 1 cut(s) 958
FaeI CATG 4 cut(s) 352, 514, 540, 1092
FalI AAGNNNNNCTT 2 cut(s) 139, 171
FaqI GGGAC 2 cut(s) 103, 213
FatI CATG 4 cut(s) 348, 510, 536, 1088
FbaI TGATCA 1 cut(s) 748
FblI GTMKAC 1 cut(s) 903
Fnu4HI GCNGC 6 cut(s) 170, 173, 335, 621, 879, 882
FokI GGATG 1 cut(s) 848
Fsp4HI GCNGC 6 cut(s) 170, 173, 335, 621, 879, 882
FspBI CTAG 4 cut(s) 21, 635, 702, 888
GluI GCNGC 6 cut(s) 170, 173, 335, 621, 879, 882
GsaI CCCAGC 1 cut(s) 691
HaeIII GGCC 2 cut(s) 15, 1083
HapII CCGG 1 cut(s) 930
HgaI GACGC 1 cut(s) 246
Hin1I GRCGYC 2 cut(s) 125, 226
Hin1II CATG 4 cut(s) 352, 514, 540, 1092
HincII GTYRAC 2 cut(s) 261, 991
HindII GTYRAC 2 cut(s) 261, 991
HinfI GANTC 8 cut(s) 190, 450, 566, 603, 652, 708, 922, 1073
HpaII CCGG 1 cut(s) 930
HphI GGTGA 4 cut(s) 239, 574, 777, 903
Hpy166II GTNNAC 6 cut(s) 261, 470, 602, 707, 904, 991
Hpy188I TCNGA 7 cut(s) 103, 224, 284, 411, 561, 738, 921
Hpy188III TCNNGA 4 cut(s) 183, 328, 767, 1049
Hpy8I GTNNAC 6 cut(s) 261, 470, 602, 707, 904, 991
HpyAV CCTTC 2 cut(s) 5, 995
HpyCH4III ACNGT 1 cut(s) 871
HpyCH4IV ACGT 5 cut(s) 6, 30, 125, 226, 906
HpyCH4V TGCA 4 cut(s) 46, 77, 982, 1037
HpyF10VI GCNNNNNNNGC 1 cut(s) 383
HpySE526I ACGT 5 cut(s) 6, 30, 125, 226, 906
Hsp92I GRCGYC 2 cut(s) 125, 226
Hsp92II CATG 4 cut(s) 352, 514, 540, 1092
KpnI GGTACC 1 cut(s) 358
Ksp22I TGATCA 1 cut(s) 748
Kzo9I GATC 2 cut(s) 728, 748
Lsp1109I GCAGC 4 cut(s) 181, 184, 607, 865
LweI GCATC 3 cut(s) 321, 395, 826
MaeI CTAG 4 cut(s) 21, 635, 702, 888
MaeII ACGT 5 cut(s) 6, 30, 125, 226, 906
MaeIII GTNAC 3 cut(s) 110, 809, 1097
MalI GATC 2 cut(s) 730, 750
MboI GATC 2 cut(s) 728, 748
MboII GAAGA 1 cut(s) 1010
MfeI CAATTG 1 cut(s) 430
MlyI GAGTC 3 cut(s) 444, 597, 702
MmeI TCCRAC 3 cut(s) 394, 619, 1101
MnlI CCTC 3 cut(s) 230, 285, 826
MseI TTAA 4 cut(s) 65, 393, 645, 1032
MslI CAYNNNNRTG 2 cut(s) 269, 486
MspI CCGG 1 cut(s) 930
MspR9I CCNGG 3 cut(s) 360, 995, 1085
MunI CAATTG 1 cut(s) 430
MvaI CCWGG 3 cut(s) 360, 995, 1085
MwoI GCNNNNNNNGC 1 cut(s) 383
NdeII GATC 2 cut(s) 728, 748
NlaIII CATG 4 cut(s) 352, 514, 540, 1092
NlaIV GGNNCC 1 cut(s) 356
NmuCI GTSAC 1 cut(s) 1097
NspI RCATGY 1 cut(s) 1092
OliI CACNNNNGTG 1 cut(s) 269
PasI CCCWGGG 1 cut(s) 359
PceI AGGCCT 1 cut(s) 15
PfeI GAWTC 5 cut(s) 190, 566, 652, 922, 1073
PflMI CCANNNNNTGG 1 cut(s) 614
PkrI GCNGC 6 cut(s) 171, 174, 336, 622, 880, 883
PleI GAGTC 3 cut(s) 444, 597, 702
PpsI GAGTC 3 cut(s) 444, 597, 702
PshBI ATTAAT 1 cut(s) 1032
Psp1406I AACGTT 1 cut(s) 6
Psp6I CCWGG 3 cut(s) 358, 993, 1083
PspFI CCCAGC 1 cut(s) 687
PspGI CCWGG 3 cut(s) 358, 993, 1083
PspN4I GGNNCC 1 cut(s) 356
RsaI GTAC 3 cut(s) 356, 517, 938
RsaNI GTAC 3 cut(s) 355, 516, 937
RseI CAYNNNNRTG 2 cut(s) 269, 486
SaqAI TTAA 4 cut(s) 65, 393, 645, 1032
SatI GCNGC 6 cut(s) 170, 173, 335, 621, 879, 882
Sau3AI GATC 2 cut(s) 728, 748
ScaI AGTACT 1 cut(s) 938
SchI GAGTC 3 cut(s) 444, 597, 702
ScrFI CCNGG 3 cut(s) 360, 995, 1085
SfaNI GCATC 3 cut(s) 321, 395, 826
SfcI CTRYAG 1 cut(s) 627
SmiMI CAYNNNNRTG 2 cut(s) 269, 486
SpeI ACTAGT 1 cut(s) 701
SseBI AGGCCT 1 cut(s) 15
SsiI CCGC 3 cut(s) 335, 881, 1043
SspMI CTAG 4 cut(s) 21, 635, 702, 888
StuI AGGCCT 1 cut(s) 15
StyD4I CCNGG 3 cut(s) 358, 993, 1083
TaaI ACNGT 1 cut(s) 871
TaiI ACGT 5 cut(s) 9, 33, 128, 229, 909
TaqI TCGA 3 cut(s) 158, 650, 711
TatI WGTACW 2 cut(s) 515, 936
TauI GCSGC 2 cut(s) 337, 884
TfiI GAWTC 5 cut(s) 190, 566, 652, 922, 1073
Tru1I TTAA 4 cut(s) 65, 393, 645, 1032
Tru9I TTAA 4 cut(s) 65, 393, 645, 1032
TscAI CASTG 1 cut(s) 477
TseFI GTSAC 1 cut(s) 1097
TseI GCWGC 4 cut(s) 169, 172, 620, 878
Tsp45I GTSAC 1 cut(s) 1097
TspDTI ATGAA 7 cut(s) 17, 337, 525, 752, 788, 831, 960
TspGWI ACGGA 1 cut(s) 259
TspRI CASTG 1 cut(s) 477
Van91I CCANNNNNTGG 1 cut(s) 614
VspI ATTAAT 1 cut(s) 1032
XapI RAATTY 3 cut(s) 310, 796, 818
XceI RCATGY 1 cut(s) 1092
XmiI GTMKAC 1 cut(s) 903
XspI CTAG 4 cut(s) 21, 635, 702, 888
ZraI GACGTC 2 cut(s) 126, 227
ZrmI AGTACT 1 cut(s) 938
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.