Rmu_sc0037344.1_g000001
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037344.1
Physical Location & Seq
Forward (+)
1 .. 545
545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037344.1_g000001.1.cds

Sequence Viewer

Length: 246 bp
gaagaaaatcacatgctaaaaacccacaatgaagaacttagcactaagcttcgacggacagaggttcttctatcacgttgcaaggaagagcttgctcgctatcgtgcttccattgggagaaacccttatgttgattttgatgaggagcaacgactgagtaacaaagtgaaggaaattgaggaggagaagttgcagttagcacaaaagttattaggcctgtgtactagtgttctaaaggtatgttaa

Protein Analysis

81

Amino Acids

9.53

Weight (kDa)

7.01

Isoelectric Point (pI)

61.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 223
AhlI ACTAGT 1 cut(s) 224
AluBI AGCT 2 cut(s) 49, 91
AluI AGCT 2 cut(s) 49, 91
AoxI GGCC 1 cut(s) 214
BcuI ACTAGT 1 cut(s) 224
BfaI CTAG 1 cut(s) 225
BsaXI ACNNNNNCTCC 2 cut(s) 173, 203
BseMII CTCAG 1 cut(s) 146
BseRI GAGGAG 3 cut(s) 158, 194, 197
BshFI GGCC 1 cut(s) 216
BsnI GGCC 1 cut(s) 216
BspANI GGCC 1 cut(s) 216
BspCNI CTCAG 1 cut(s) 147
BspQI GCTCTTC 1 cut(s) 81
Bst6I CTCTTC 1 cut(s) 81
BstC8I GCNNGC 2 cut(s) 93, 97
BstDEI CTNAG 3 cut(s) 38, 45, 155
BstNSI RCATGY 1 cut(s) 16
BsuRI GGCC 1 cut(s) 216
Cac8I GCNNGC 2 cut(s) 93, 97
Csp6I GTAC 1 cut(s) 222
CviAII CATG 1 cut(s) 13
CviJI RGCY 3 cut(s) 49, 91, 216
CviKI_1 RGCY 3 cut(s) 49, 91, 216
CviQI GTAC 1 cut(s) 222
DdeI CTNAG 3 cut(s) 38, 45, 155
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco147I AGGCCT 1 cut(s) 216
FaeI CATG 1 cut(s) 16
FaiI YATR 3 cut(s) 14, 129, 241
FatI CATG 1 cut(s) 12
FspBI CTAG 1 cut(s) 225
HaeIII GGCC 1 cut(s) 216
Hin1II CATG 1 cut(s) 16
HindIII AAGCTT 1 cut(s) 47
Hpy166II GTNNAC 1 cut(s) 222
Hpy8I GTNNAC 1 cut(s) 222
Hpy99I CGWCG 1 cut(s) 57
HpyAV CCTTC 1 cut(s) 163
HpyCH4IV ACGT 1 cut(s) 76
HpyCH4V TGCA 2 cut(s) 81, 193
HpyF3I CTNAG 3 cut(s) 38, 45, 155
HpySE526I ACGT 1 cut(s) 76
Hsp92II CATG 1 cut(s) 16
LguI GCTCTTC 1 cut(s) 81
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 1 cut(s) 230
MaeI CTAG 1 cut(s) 225
MaeII ACGT 1 cut(s) 76
MaeIII GTNAC 1 cut(s) 158
MboII GAAGA 4 cut(s) 14, 44, 59, 98
MluCI AATT 1 cut(s) 174
MnlI CCTC 4 cut(s) 55, 136, 172, 175
MseI TTAA 1 cut(s) 244
NlaIII CATG 1 cut(s) 16
NspI RCATGY 1 cut(s) 16
PceI AGGCCT 1 cut(s) 216
PciSI GCTCTTC 1 cut(s) 81
RsaI GTAC 1 cut(s) 223
RsaNI GTAC 1 cut(s) 222
SapI GCTCTTC 1 cut(s) 81
SaqAI TTAA 1 cut(s) 244
SetI ASST 5 cut(s) 51, 66, 79, 93, 240
SgeI CNNG 8 cut(s) 25, 87, 94, 104, 108, 116, 229, 237
SpeI ACTAGT 1 cut(s) 224
Sse9I AATT 1 cut(s) 174
SseBI AGGCCT 1 cut(s) 216
SspMI CTAG 1 cut(s) 225
StuI AGGCCT 1 cut(s) 216
TaiI ACGT 1 cut(s) 79
TaqI TCGA 1 cut(s) 52
TasI AATT 1 cut(s) 174
TatI WGTACW 1 cut(s) 221
Tru1I TTAA 1 cut(s) 244
Tru9I TTAA 1 cut(s) 244
TspDTI ATGAA 1 cut(s) 45
TspGWI ACGGA 1 cut(s) 70
XceI RCATGY 1 cut(s) 16
XspI CTAG 1 cut(s) 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.