Rmu_sc0037819.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037819.1
Physical Location & Seq
Reverse (-)
2 .. 280
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037819.1_g000001.1.cds

Sequence Viewer

Length: 279 bp
atggcattgccaagaatctccaagactcatcaaaacctctggaaatcaataaaccccatcaacccaaccgcgttcttttccctcatcttcaccaacatccacacgccctcatcgaattcacccagacccatttgcaccaaaacccactctgacccttttcttcctaatccagacgtgggtcacgtcgccgatggtctcatttccatcttcaccaagcaacctttctccccagacaacccagatttgaagcattttgcttcaagaatcaccccaaaagca

Protein Analysis

93

Amino Acids

10.33

Weight (kDa)

9.74

Isoelectric Point (pI)

42.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015139)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 71
AciI CCGC 1 cut(s) 69
AcsI RAATTY 1 cut(s) 115
AfiI CCNNNNNNNGG 1 cut(s) 176
AgsI TTSAA 2 cut(s) 247, 261
AjiI CACGTC 2 cut(s) 175, 184
AjuI GAANNNNNNNTTGG 2 cut(s) 206, 238
Alw26I GTCTC 1 cut(s) 200
ApoI RAATTY 1 cut(s) 115
AsuHPI GGTGA 4 cut(s) 82, 111, 202, 259
BccI CCATC 3 cut(s) 65, 185, 212
BcoDI GTCTC 1 cut(s) 200
BmgBI CACGTC 2 cut(s) 175, 184
BoxI GACNNNNGTC 1 cut(s) 177
BsaI GGTCTC 1 cut(s) 200
Bsc4I CCNNNNNNNGG 1 cut(s) 176
Bse3DI GCAATG 1 cut(s) 5
BseGI GGATG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 176
BseMI GCAATG 1 cut(s) 5
Bsh1236I CGCG 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 176
BsmAI GTCTC 1 cut(s) 200
Bso31I GGTCTC 1 cut(s) 200
BspACI CCGC 1 cut(s) 69
BspFNI CGCG 1 cut(s) 71
BspTNI GGTCTC 1 cut(s) 200
BsrDI GCAATG 1 cut(s) 5
BstF5I GGATG 1 cut(s) 96
BstFNI CGCG 1 cut(s) 71
BstMAI GTCTC 1 cut(s) 200
BstPAI GACNNNNGTC 1 cut(s) 177
BstUI CGCG 1 cut(s) 71
BtrI CACGTC 2 cut(s) 175, 184
BtsCI GGATG 1 cut(s) 96
Eco31I GGTCTC 1 cut(s) 200
EcoRI GAATTC 1 cut(s) 115
FokI GGATG 1 cut(s) 83
HinfI GANTC 3 cut(s) 15, 25, 264
HphI GGTGA 4 cut(s) 82, 111, 202, 259
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 3 cut(s) 40, 170, 261
Hpy99I CGWCG 1 cut(s) 188
HpyCH4IV ACGT 2 cut(s) 174, 183
HpyCH4V TGCA 1 cut(s) 135
HpySE526I ACGT 2 cut(s) 174, 183
LpnPI CCDG 5 cut(s) 25, 136, 183, 243, 252
MaeII ACGT 2 cut(s) 174, 183
MaeIII GTNAC 1 cut(s) 179
MboII GAAGA 3 cut(s) 79, 152, 199
MluCI AATT 1 cut(s) 115
MlyI GAGTC 1 cut(s) 19
MnlI CCTC 3 cut(s) 47, 92, 118
MvnI CGCG 1 cut(s) 71
NmuCI GTSAC 1 cut(s) 179
PcsI WCGNNNNNNNCGW 2 cut(s) 110, 180
PfeI GAWTC 2 cut(s) 15, 264
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
PshAI GACNNNNGTC 1 cut(s) 177
SchI GAGTC 1 cut(s) 19
SetI ASST 4 cut(s) 39, 177, 186, 223
Sse9I AATT 1 cut(s) 115
SsiI CCGC 1 cut(s) 69
TaiI ACGT 2 cut(s) 177, 186
TaqI TCGA 1 cut(s) 113
TasI AATT 1 cut(s) 115
TfiI GAWTC 2 cut(s) 15, 264
TseFI GTSAC 1 cut(s) 179
Tsp45I GTSAC 1 cut(s) 179
XapI RAATTY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.