Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0039259.1

Orthogroup ID

OG0003006

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 1472

Gene Structure 1471 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0039259.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 698 bp

atgggattcagatttcagaatctcaattccataggcacaaggctcgctgctctatacgtagccaagcattctcacccacaccccacaataatctcccaaaccctcaattcccatctccaagaccattctttgattctccatcaaatcccgatttactcaattcccagaagatggcatttgggccattcccacggccctgaggaggattatggcaaagagggcgagaagatcttccggctgggattggctgctgatattggtcttgcttccggaaaagctttgactggttacttatctggcagcaccgccataattgccgacgccgcccattcagtctccgacgtggttcttagcggcattgcgctattgtcttttaaagttgcaaaggctccgagagacaaagaacacccatatggacatggtaaatttgagacgctaggagcacttggaatctcttttatgctgttgggaactgctggtggcattgcttggcatgctttggatattttgatgggattgtattcagcaaatccagaagtagctagtcagtcattgacacatcataaccagcaccatagcggacatcaccatggagttgacatggagcacccaaccctagctttgggcatgacggttctctcgattggtgtcaaagaagggctatactggatcacaaaacgggcaggagagaaacaagg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_efflux ZT_dimer

Protein Analysis

233

Amino Acids

25.14

Weight (kDa)

7.41

Isoelectric Point (pI)

19.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003006)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G47830 AT2G47830
fragaria_vesca	FvH4_c6g00080 FvH4_c6g00080 FvH4_c6g00080 FvH4_c6g00080 FvH4_c6g00080 FvH4_c6g00080 FvH4_c6g00080 FvH4_c6g00080 FvH4_c6g00110 FvH4_c6g00110 FvH4_c6g00110 FvH4_c6g00110 FvH4_c6g00110 FvH4_c6g00110 FvH4_c6g00110
malus_domestica	MD03G1284200.v1.1
prunus_persica	Prupe.8G255700_v2.0.a1 Prupe.8G255700_v2.0.a1 Prupe.8G255700_v2.0.a1 Prupe.8G255700_v2.0.a1
pyrus_communis	pycom03g22500
rosa_chinensis	RchiOBHm_Chr6g0293181
rosa_laevigata	RLG00000011969
rosa_multiflora	Rmu_co8409675.1_g000001 Rmu_sc0014786.1_g000003 Rmu_sc0039259.1_g000001 Rmu_sc0042811.1_g000001 Rmu_sc0042818.1_g000001
rosa_roxburghii	Rroxscaffold_7G00174370
rosa_rugosa	Rorug06G0233200 Rorug06G0233300
rosa_samantha	Rh6AG345800 Rh6BG353600 Rh6CG360000 Rh6DG346400
rosa_wichuraiana	Rw6G030140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	171
AccIII	TCCGGA	1 cut(s)	269
AciI	CCGC	4 cut(s)	306, 324, 354, 579
AclWI	GGATC	1 cut(s)	677
AcsI	RAATTY	1 cut(s)	425
AcyI	GRCGYC	1 cut(s)	321
AfiI	CCNNNNNNNGG	3 cut(s)	171, 202, 622
AjiI	CACGTC	1 cut(s)	343
AluBI	AGCT	3 cut(s)	278, 542, 620
AluI	AGCT	3 cut(s)	278, 542, 620
Alw21I	GWGCWC	2 cut(s)	445, 609
Alw26I	GTCTC	3 cut(s)	340, 390, 425
AlwI	GGATC	1 cut(s)	677
Aor13HI	TCCGGA	1 cut(s)	269
AoxI	GGCC	2 cut(s)	181, 193
ApeKI	GCWGC	3 cut(s)	47, 248, 300
ApoI	RAATTY	1 cut(s)	425
Asp700I	GAANNNNTTC	1 cut(s)	230
AspLEI	GCGC	1 cut(s)	364
AspS9I	GGNCC	2 cut(s)	181, 194
AsuHPI	GGTGA	2 cut(s)	65, 578
AxyI	CCTNAGG	1 cut(s)	198
Bbv12I	GWGCWC	2 cut(s)	445, 609
BbvI	GCAGC	3 cut(s)	34, 235, 312
BccI	CCATC	4 cut(s)	120, 147, 165, 505
BceAI	ACGGC	1 cut(s)	208
BcgI	CGANNNNNNTGC	2 cut(s)	25, 59
BcoDI	GTCTC	3 cut(s)	340, 390, 425
BfaI	CTAG	3 cut(s)	437, 543, 617
BglII	AGATCT	1 cut(s)	228
BisI	GCNGC	5 cut(s)	48, 249, 301, 324, 355
BlsI	GCNGC	5 cut(s)	49, 250, 302, 325, 356
BmgBI	CACGTC	1 cut(s)	343
BmgT120I	GGNCC	2 cut(s)	181, 194
BmiI	GGNNCC	1 cut(s)	390
BsaAI	YACGTR	1 cut(s)	58
BsaHI	GRCGYC	1 cut(s)	321
BsaJI	CCNNGG	2 cut(s)	190, 589
BsaWI	WCCGGW	1 cut(s)	269
Bsc4I	CCNNNNNNNGG	3 cut(s)	171, 202, 622
Bse1I	ACTGG	2 cut(s)	289, 671
Bse21I	CCTNAGG	1 cut(s)	198
Bse3DI	GCAATG	2 cut(s)	357, 483
BseAI	TCCGGA	1 cut(s)	269
BseDI	CCNNGG	2 cut(s)	190, 589
BseLI	CCNNNNNNNGG	3 cut(s)	171, 202, 622
BseMI	GCAATG	2 cut(s)	357, 483
BseMII	CTCAG	1 cut(s)	189
BseNI	ACTGG	2 cut(s)	289, 671
BseRI	GAGGAG	1 cut(s)	215
BseXI	GCAGC	3 cut(s)	34, 235, 312
BseYI	CCCAGC	1 cut(s)	238
BshFI	GGCC	2 cut(s)	183, 195
BsiHKAI	GWGCWC	2 cut(s)	445, 609
BsiSI	CCGG	2 cut(s)	235, 270
BslI	CCNNNNNNNGG	3 cut(s)	171, 202, 622
BsmAI	GTCTC	3 cut(s)	340, 390, 425
BsmBI	CGTCTC	1 cut(s)	425
BsmI	GAATGC	1 cut(s)	67
BsnI	GGCC	2 cut(s)	183, 195
Bsp1286I	GDGCHC	2 cut(s)	445, 609
Bsp13I	TCCGGA	1 cut(s)	269
Bsp143I	GATC	2 cut(s)	228, 669
Bsp19I	CCATGG	1 cut(s)	589
BspACI	CCGC	4 cut(s)	306, 324, 354, 579
BspANI	GGCC	2 cut(s)	183, 195
BspCNI	CTCAG	1 cut(s)	190
BspEI	TCCGGA	1 cut(s)	269
BspLI	GGNNCC	1 cut(s)	390
BspPI	GGATC	1 cut(s)	677
BsrDI	GCAATG	2 cut(s)	357, 483
BsrI	ACTGG	2 cut(s)	289, 671
BssECI	CCNNGG	2 cut(s)	190, 589
BssMI	GATC	2 cut(s)	228, 669
BssNI	GRCGYC	1 cut(s)	321
BssT1I	CCWWGG	1 cut(s)	589
Bst4CI	ACNGT	1 cut(s)	634
BstACI	GRCGYC	1 cut(s)	321
BstBAI	YACGTR	1 cut(s)	58
BstC8I	GCNNGC	2 cut(s)	45, 495
BstDEI	CTNAG	2 cut(s)	198, 350
BstDSI	CCRYGG	2 cut(s)	190, 589
BstHHI	GCGC	1 cut(s)	364
BstKTI	GATC	2 cut(s)	231, 672
BstMAI	GTCTC	3 cut(s)	340, 390, 425
BstMBI	GATC	2 cut(s)	228, 669
BstMWI	GCNNNNNNNGC	4 cut(s)	219, 314, 323, 494
BstNSI	RCATGY	1 cut(s)	497
BstSNI	TACGTA	1 cut(s)	58
BstV1I	GCAGC	3 cut(s)	34, 235, 312
BstX2I	RGATCY	1 cut(s)	228
BstYI	RGATCY	1 cut(s)	228
Bsu36I	CCTNAGG	1 cut(s)	198
BsuRI	GGCC	2 cut(s)	183, 195
BtgI	CCRYGG	2 cut(s)	190, 589
BtrI	CACGTC	1 cut(s)	343
Cac8I	GCNNGC	2 cut(s)	45, 495
CfoI	GCGC	1 cut(s)	364
Cfr13I	GGNCC	2 cut(s)	181, 194
CseI	GACGC	2 cut(s)	329, 442
CviAII	CATG	5 cut(s)	419, 494, 590, 601, 628
DdeI	CTNAG	2 cut(s)	198, 350
DpnI	GATC	2 cut(s)	230, 671
DpnII	GATC	2 cut(s)	228, 669
DraI	TTTAAA	1 cut(s)	376
Eco105I	TACGTA	1 cut(s)	58
Eco130I	CCWWGG	1 cut(s)	589
Eco81I	CCTNAGG	1 cut(s)	198
EcoT14I	CCWWGG	1 cut(s)	589
ErhI	CCWWGG	1 cut(s)	589
Esp3I	CGTCTC	1 cut(s)	425
FaeI	CATG	5 cut(s)	422, 497, 593, 604, 631
FatI	CATG	5 cut(s)	418, 493, 589, 600, 627
FauNDI	CATATG	1 cut(s)	412
Fnu4HI	GCNGC	5 cut(s)	48, 249, 301, 324, 355
Fsp4HI	GCNGC	5 cut(s)	48, 249, 301, 324, 355
FspBI	CTAG	3 cut(s)	437, 543, 617
GlaI	GCGC	1 cut(s)	363
GluI	GCNGC	5 cut(s)	48, 249, 301, 324, 355
GsaI	CCCAGC	1 cut(s)	242
HaeIII	GGCC	2 cut(s)	183, 195
HapII	CCGG	2 cut(s)	235, 270
HgaI	GACGC	2 cut(s)	329, 442
HhaI	GCGC	1 cut(s)	364
Hin1I	GRCGYC	1 cut(s)	321
Hin1II	CATG	5 cut(s)	422, 497, 593, 604, 631
Hin6I	GCGC	1 cut(s)	362
HinP1I	GCGC	1 cut(s)	362
HincII	GTYRAC	1 cut(s)	598
HindII	GTYRAC	1 cut(s)	598
HindIII	AAGCTT	1 cut(s)	276
HinfI	GANTC	4 cut(s)	6, 19, 133, 450
HpaII	CCGG	2 cut(s)	235, 270
HphI	GGTGA	2 cut(s)	65, 578
Hpy166II	GTNNAC	1 cut(s)	598
Hpy188I	TCNGA	4 cut(s)	11, 18, 340, 393
Hpy188III	TCNNGA	4 cut(s)	148, 270, 533, 640
Hpy8I	GTNNAC	1 cut(s)	598
Hpy99I	CGWCG	2 cut(s)	323, 344
HpyAV	CCTTC	1 cut(s)	650
HpyCH4III	ACNGT	1 cut(s)	634
HpyCH4IV	ACGT	2 cut(s)	57, 342
HpyCH4V	TGCA	1 cut(s)	383
HpyF10VI	GCNNNNNNNGC	4 cut(s)	219, 314, 323, 494
HpyF3I	CTNAG	2 cut(s)	198, 350
HpySE526I	ACGT	2 cut(s)	57, 342
Hsp92I	GRCGYC	1 cut(s)	321
Hsp92II	CATG	5 cut(s)	422, 497, 593, 604, 631
HspAI	GCGC	1 cut(s)	362
Kpn2I	TCCGGA	1 cut(s)	269
Kzo9I	GATC	2 cut(s)	228, 669
LmnI	GCTCC	3 cut(s)	394, 440, 604
Lsp1109I	GCAGC	3 cut(s)	34, 235, 312
MaeI	CTAG	3 cut(s)	437, 543, 617
MaeII	ACGT	2 cut(s)	57, 342
MaeIII	GTNAC	1 cut(s)	287
MalI	GATC	2 cut(s)	230, 671
MboI	GATC	2 cut(s)	228, 669
MboII	GAAGA	3 cut(s)	180, 223, 238
MflI	RGATCY	1 cut(s)	228
MhlI	GDGCHC	2 cut(s)	445, 609
MluCI	AATT	5 cut(s)	25, 106, 159, 312, 425
MmeI	TCCRAC	1 cut(s)	363
MnlI	CCTC	4 cut(s)	113, 193, 196, 211
MroI	TCCGGA	1 cut(s)	269
MroXI	GAANNNNTTC	1 cut(s)	230
MseI	TTAA	1 cut(s)	375
MslI	CAYNNNNRTG	2 cut(s)	411, 588
MspI	CCGG	2 cut(s)	235, 270
Mva1269I	GAATGC	1 cut(s)	67
MwoI	GCNNNNNNNGC	4 cut(s)	219, 314, 323, 494
NcoI	CCATGG	1 cut(s)	589
NdeI	CATATG	1 cut(s)	412
NdeII	GATC	2 cut(s)	228, 669
NlaIII	CATG	5 cut(s)	422, 497, 593, 604, 631
NlaIV	GGNNCC	1 cut(s)	390
NspI	RCATGY	1 cut(s)	497
PaeI	GCATGC	1 cut(s)	497
PcsI	WCGNNNNNNNCGW	1 cut(s)	638
PctI	GAATGC	1 cut(s)	67
PdmI	GAANNNNTTC	1 cut(s)	230
PfeI	GAWTC	4 cut(s)	6, 19, 133, 450
PflMI	CCANNNNNTGG	1 cut(s)	171
PkrI	GCNGC	5 cut(s)	49, 250, 302, 325, 356
Ppu21I	YACGTR	1 cut(s)	58
PspFI	CCCAGC	1 cut(s)	238
PspN4I	GGNNCC	1 cut(s)	390
PspPI	GGNCC	2 cut(s)	181, 194
PsuI	RGATCY	1 cut(s)	228
RseI	CAYNNNNRTG	2 cut(s)	411, 588
SaqAI	TTAA	1 cut(s)	375
SatI	GCNGC	5 cut(s)	48, 249, 301, 324, 355
Sau3AI	GATC	2 cut(s)	228, 669
Sau96I	GGNCC	2 cut(s)	181, 194
SduI	GDGCHC	2 cut(s)	445, 609
SetI	ASST	5 cut(s)	60, 280, 345, 544, 622
SmiMI	CAYNNNNRTG	2 cut(s)	411, 588
SnaBI	TACGTA	1 cut(s)	58
SphI	GCATGC	1 cut(s)	497
Sse9I	AATT	5 cut(s)	25, 106, 159, 312, 425
SsiI	CCGC	4 cut(s)	306, 324, 354, 579
SspMI	CTAG	3 cut(s)	437, 543, 617
StyI	CCWWGG	1 cut(s)	589
TaaI	ACNGT	1 cut(s)	634
TaiI	ACGT	2 cut(s)	60, 345
TaqI	TCGA	1 cut(s)	641
TasI	AATT	5 cut(s)	25, 106, 159, 312, 425
TauI	GCSGC	2 cut(s)	326, 357
TfiI	GAWTC	4 cut(s)	6, 19, 133, 450
Tru1I	TTAA	1 cut(s)	375
Tru9I	TTAA	1 cut(s)	375
TseI	GCWGC	3 cut(s)	47, 248, 300
Van91I	CCANNNNNTGG	1 cut(s)	171
XapI	RAATTY	1 cut(s)	425
XceI	RCATGY	1 cut(s)	497
XmnI	GAANNNNTTC	1 cut(s)	230
XspI	CTAG	3 cut(s)	437, 543, 617

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.