Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000032.1

Orthogroup ID

OG0008640

Physical Location & Seq

Genomic Coordinates Reverse (-)

190 .. 10410

Gene Structure 10221 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000032.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 6630 bp

atgttggcggcgagttccggcgctggtggttccgttctccaactccggaccaaaccttccgtcctcgcttcacctcagctcaatgcctcgccgatagcgaggctaagcaccagagccactgctcgctctggttccaaagctattgcgaagaagttcttcgggacgagattgagggctgccggatccgacaggctgcacttatggcgatccgacggtcccggccgctcgccgaagctgcgggtggtggtccggaacatgctctctgccgtgccggagaagccgctcgggctatacgacccggcgatggataaggactcgtgcggtgttggcttcgtggcggaattgtccggtgaaagcagccgtaaaacgattacggatgctctggaaatgttggtgcggatgacacacagaggagcatgtggatgtgaaacaaacactggtgatggagctggtgttcttgtggcgattcctcacgatttctataaggaggctgccaaagacaatgggtttgagcttccaccgctgggtgagtatgctgttggtatgctctacttgcctacatcggagagtcgtagagaggaaagcaaaaatgtgtttacaaaggttgccgagtctcttggccatactgttcttgggtggcgatcagttcccactgataactcagatttggggaattctgctctccagacagaacctgttattgagcaagtgttccttactccaactccgaggtcgaaagttgatcttgagcgccagatgtacatacttagaagggtttcaatggttgccatccgtgctgcattaaaccttcaacatggtggtgctaaagatttctacatatgttcactttcctcgaggacgattgtttacaagggtcagctgaaacccgaacagctgaagggttactattatgcagatcttggcaatgaaaggtttacgagctacatggccctggtacattctcgattctcaacaaatacttttcccagctgggatcgtgctcagcccatgcgtgtcattggccacaatggagaaatcaacacccttagaggaaatgttaactggatgaaggcacgtgagggactgcttaagtgtactgaacttggtttatcaaaaaatgagttaaagaagctgttaccaattgtggatgccagttcatccgattcaggagcttttgatggtgtccttgagcttctagttcgagctggcagaagcctccctgaagctattatgatgatgattcctgaagcatggcaaaatgacaaaaacatggatcctgataggagagcactgtatgaatatttctcatctctcatggagccatgggatgggccagctctaatatcatttactgatggacgctatctgggagctacattggatcggaatggactccgaccgggtcgcttttacgtcacccacagtggacgagttattatggccagtgaagttggggttgtagatgtacctccagaagatgtctgcaggaaaggaagacttaaccctggaatgatgcttttggtggattttgagaatcatatagtggtagatgatgaagccttgaagcagcaatattcactggcaaggccgtatggggagtggcttaaaaggcagaagattgagctcaaggacatagttgattctgttcatgaatctgacagggtgcctccatccatagctggagttgttcctgcatctactgatgatgacaacatggaaaacatgggagtccatggtttactggcaccactgaaggcttttggttacacagttgaagccttggaaatgttgttgcttcctatggcaaaagatggtgtagaggctcttgggtcaatgggaaatgatacccccttggctgttatgtccaatagagaaaagcttacatttgagtatttcaagcaaatgtttgcccaagtaacaaaccctccaattgatccaattcgagaaaaggtagtcacatctatggaatgtatgatcggtccagaaggtgatctaacagaaaccactgaagaacaatgccatcgtctctcactcaaaggtcctcttttaagcattgaggaaatggaggcaatcaaaaaaatgaattacagaggttggcgctgtaaggttcttgacataacttactccaaggaacgtggtagaaagggattggaggagaccttggataggatctgtgctgaagcacgcgaggcaattaaaaagggatataccacactggtgctttcagacagagccttctccccaaaatgtgttgctgtaagctcactcttggctgttggtgctgttcatcaacatctagttaaaaatcttgagcgcacgcgagtagggttgataattgaatctgccgagccacgtgaggtacaccatttctgtacattagttggattcggtgcagatgccatctgcccctacctggctgtagaggctatttggagactgcaggttgatggaaagatcccaccaaaatctaatggtacaatatattccaaggatgaactggttaaaaagtacttcaaagcaagcaactatggaatgcagaaggttcttgccaagatggggatatctactttggcctcttacaagggtgcacagatttttgaagctttgggtctttcatctgaagtgattgagaggtgctttgcaggaactcctagtagagttgagggggcaacatttgagatgcttgctcgtgatggacttcatctgcatgatttggcatttccttctcgggcttttcctccgggtagtgcagaagctgtggcactaccaaatccaggggattatcattggagaaaaggtggtgaagttcacctaaatgatccttttgctatttccaagcttcaggaggctgccagaactaacagtgtggcggcatataaagaatactccaagctcattcatcaattaaataaagcctgcaatctccgtggtcttctgaaatttaaaaacacagagcagcaaattgacttggatgaagtggaacctgccagtgaaattgttaaacggttctgtactggggcaatgagttatggatcaatatcattggaggcacacactacactggccattgctatgaacagaatgggaggaaagtcaaatacaggtgagggaggtgagcagccctctcgtatggagcctcttcctgatggttcaaggaatccaaagaggagtgcaattaagcaggttgcaagtgggagatttggagtttcaagttactatcttacaaatgctgatgaactccaaataaaaatggctcagggggccaagcccggtgaaggaggtgagcttcctggtcacaaggttattggagacattgctgttaccaggaattccactgctggtgtgggacttatcagcccacctccccatcatgatatctactcaattgaagaccttgctcaattaattcatgatcttaagaatgctaacccaggggctcgaataagcgtcaagttagtgtctgaagctggtgtaggagtagttgctagtggagttgtgaaggggcatgctgaccatgttttaattgccggacatgatggaggcactggtgcctccagatggactggcattaagaatgctgggcttccatgggaacttggcttggctgagacccatcaaaccctggttgctaatgatcttcgtggccgcacagttctccagacagatggccaactaaaaactggaagagatgtggccatagccgcacttcttggtgcagaagagtttgggttcagcacggcacccctcataacccttggctgcattatgatgcggaagtgccacaagaacacctgtcctgtcggaattgcaacccaagatccagtacttcgtgagaagtttgctggagaacctgaacatgttatcaactttttcttcatggtagctgaggaggtgagagagataatgtcacaacttggttttcgaactttaaatgaaatggttggtcgttcagatatgcttgaagttgacaaagaagttactaaaggcaatgagaagctggacaacattgatctttccctgttacttagacctgctgcagacattcggccagaagctgcacaatattgtgttcagaaacaggaccatgggttggacatggctcttgaccacaaacttatttcgctgtccagttctgctatagagaaggctcttcctgcatactttgaaacaccgatttgcaatgtgaatcgtgctgttggaacaatgcttagtcatgaggtgaccaaacgttacaacagggaagggcttccagcagacaccattcatatcaaattcattggaagtgcaggccagagccttggagctttcctctgccctggcatcacacttgagcttgaaggtgacagcaatgattacgttggtaaaggattgtctggtggcaagatcgtagtgtatccccccaagggaagcaagtttgacccgaaagacaacattgtcattggtaatgtagctctttatggtgccactagtggggaggcatatttcaatggaatggcagcagaaagattctgtgttcgcaattcaggggcaagggcagtagttgaaggtgtcggtgatcatggctgtgagtacatgacaggtggcactgttgttgtgcttgggaaaactggcaggaactttgctgctggtatgagtggtggcatagcctacgttcttgatgtggatggaaaatttttgtcccgatgcaatcctgagcttgtagatcttgataaagttgaaggagaagatagtatgactcttaagatgatgatacagcagcatcagcgtcatacaaaaagcttgctggccagtgaagtactggctgattttgagaatcttttgcctaaattcatcaaggttatccccagagagtacaagcgtgcacttgcaaacctgagggaggaggccaccaaacaggcagttgatcaagctgatgaagaagctcaggagcaagaggaagaggtggaaataaaggggaaagatgcatttgaagaacttaagaagatggcatctgcatctttaaatgggacatccaatcaggtagaagatgctgaaacattgaagaggcccagtgaggtcagcaaagctgttaaacaccggggtttcatttcttatgagcgtgagggcgttcaatacagggatcccaaagttcggatgaatgactggaaggaagttatggaggaaactaaacctggtccacttgtgaatacacagtcagcacgttgcatggactgtggcactcctttctgccatcaggaaaacactgggtgtcctcttggtaacaaaatacctgagttcaatgaattggtgtaccagaataggtggcatgaagcattagagagactcctcgagacaaataacttccctgagtttactggtcgagtttgcccagcaccttgtgaaggttcatgtgttctgggtattattgagaatcctgtctctattaaaagcattgaatgtgccatcatagacaaggcttttgaggaaggttggatggtgccacggcctccactcaagagaactgggaaaaaggttgccattgtcggaagtgggcctgctgggctagctgctgctgatcaactaaacagaataggtcatacagtgacagtttacgagcgtgctgatagaattggagggctgatgatgtatggagtgcctaatatgaaggctgacaaagttgatatagttcaacggcgggttaaccttatggccgaggaaggtgtcaactttgtggtcaatgctaatgttggaaatgattcttcctactcgtttgatcgccttcgggaggataacaatgcgattattttagcagtaggcgcaacgaagccaagggaccttcccgtacctgggcgagagctgtctggagtacatttcgctatggagtttcttcatgcaaacaccaaaagcttgcttgatagcaatctcgagaatggtaactatatttctgccaagggtaagaaggttgtggtcattggtggaggtgacactggcactgattgtattggaacctctgttcgccatggctgtactaacattgttaatttggagcttctccctgagccaccacgaacaagggcaccaggaaacccttggccacagtggcctcgtatattccgagtagattatgggcatgcagaagttgcagccaagtttggcaaagatccaagaacttatgaggtgctgactaagaggtttgtgggagatgagaatggggttgtgaagggactagaggtagtacgtgtcaaatgggagaaggatgctactggcaagttccaatttaaggaaatcgagggctctgaggagataattgaggccgatctcgtccttctagcaatggggttccttggacctgaagcggtgattgcagagaagttgggcttggagcgtgacaatcgctcaaacttcaaggcagattatggtcggttctcaaccaatgtggatggggtctttgctgctggggattgccggcgtggtcaatccctggtggtgtgggcaatctcagagggacggcaagcagctgcacaggttgacaactacctctgcaaggaagaagaagaccacacaaacagcaacgggatccctgaatccgatctattgaagcggcatcaagaaatcagcaagagccataagacagttgcaagcacaccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006082 GO:0006520 GO:0006536 GO:0006537 GO:0006541 GO:0006807 GO:0008150 GO:0008152 GO:0008652 GO:0009058 GO:0009064 GO:0009084 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0009719 GO:0009725 GO:0009735 GO:0009987 GO:0010033 GO:0010035 GO:0010038 GO:0015930 GO:0016040 GO:0016053 GO:0016491 GO:0016638 GO:0016639 GO:0019676 GO:0019740 GO:0019752 GO:0032502 GO:0040007 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0043648 GO:0043650 GO:0044237 GO:0044238 GO:0044249 GO:0044281 GO:0044283 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464 GO:0045181 GO:0046394 GO:0046686 GO:0048589 GO:0050896 GO:0055114 GO:0060359 GO:0071704 GO:1901564 GO:1901566 GO:1901576 GO:1901605 GO:1901607 GO:1901698

KEGG Pathways

Metabolic & Signaling

ko00250 ko00910 ko01100 ko01110 ko01120 ko01130 ko01230 map00250 map00910 map01100 map01110 map01120 map01130 map01230

Pfam Domains

Protein Families

Fer4_20 GATase_2 GXGXG Glu_syn_central Glu_synthase Pyr_redox_2

Protein Analysis

2209

Amino Acids

241.88

Weight (kDa)

6.21

Isoelectric Point (pI)

34.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008640)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G53460 AT5G53460 AT5G53460
fragaria_vesca	FvH4_7g31770 FvH4_7g31770 FvH4_7g31770
malus_domestica	MD01G1219500.v1.1 MD07G1290500.v1.1
prunus_persica	Prupe.2G311700_v2.0.a1 Prupe.2G311700_v2.0.a1 Prupe.2G311700_v2.0.a1
pyrus_communis	pycom01g22930 pycom07g26320
rosa_chinensis	RchiOBHm_Chr1g0381001
rosa_laevigata	RLG00000026253
rosa_multiflora	Rmu_ssc0000032.1_g000001
rosa_roxburghii	Rroxscaffold_4G00278870
rosa_rugosa	Rorug01G0426400
rosa_samantha	Rh1AG450100 Rh1BG406100 Rh1CG420100 Rh1DG436600
rosa_wichuraiana	Rw1G039220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	4433
AbsI	CCTCGAGG	1 cut(s)	853
Acc36I	ACCTGC	4 cut(s)	2431, 2992, 3172, 4039
AccB1I	GGYRCC	7 cut(s)	1663, 1744, 3548, 3739, 4460, 5476, 6055
AccB7I	CCANNNNNTGG	2 cut(s)	1328, 4090
AccBSI	CCGCTC	2 cut(s)	225, 283
AccII	CGCG	2 cut(s)	2187, 2320
AccIII	TCCGGA	2 cut(s)	45, 249
AclI	AACGTT	1 cut(s)	4228
AcsI	RAATTY	6 cut(s)	673, 2939, 3328, 4271, 4670, 4826
AcvI	CACGTG	2 cut(s)	1076, 2354
AdeI	CACNNNGTG	2 cut(s)	5247, 5378
AflII	CTTAAG	4 cut(s)	1088, 3416, 4739, 4976
AflIII	ACRYGT	2 cut(s)	3856, 6217
AhlI	ACTAGT	1 cut(s)	4466
AjuI	GAANNNNNNNTTGG	2 cut(s)	6341, 6373
AleI	CACNNNNGTG	1 cut(s)	2216
AloI	GAACNNNNNNTCC	4 cut(s)	438, 470, 5976, 6008
Alw21I	GWGCWC	5 cut(s)	1003, 1291, 1626, 2590, 4864
Alw26I	GTCTC	9 cut(s)	618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
Alw44I	GTGCAC	2 cut(s)	2586, 4860
AlwNI	CAGNNNCTG	3 cut(s)	695, 2756, 4055
Ama87I	CYCGRG	5 cut(s)	284, 853, 2727, 5327, 5903
Aor13HI	TCCGGA	2 cut(s)	45, 249
ApaLI	GTGCAC	2 cut(s)	2586, 4860
ApoI	RAATTY	6 cut(s)	673, 2939, 3328, 4271, 4670, 4826
ArsI	GACNNNNNNTTYG	6 cut(s)	45, 77, 491, 523, 5441, 5473
AseI	ATTAAT	1 cut(s)	3404
Asp700I	GAANNNNTTC	5 cut(s)	152, 155, 775, 4245, 5734
AspLEI	GCGC	5 cut(s)	23, 753, 2100, 2316, 5798
AsuC2I	CCSGG	6 cut(s)	219, 299, 1401, 2742, 3270, 5078
AsuII	TTCGAA	1 cut(s)	3922
AsuNHI	GCTAGC	1 cut(s)	5542
AvaI	CYCGRG	5 cut(s)	284, 853, 2727, 5327, 5903
AvaII	GGWCC	9 cut(s)	48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
AxyI	CCTNAGG	1 cut(s)	4874
BaeGI	GKGCMC	3 cut(s)	2590, 4864, 6058
BalI	TGGCCA	8 cut(s)	621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
BamHI	GGATCC	4 cut(s)	182, 1273, 5119, 6555
BanI	GGYRCC	7 cut(s)	1663, 1744, 3548, 3739, 4460, 5476, 6055
BanII	GRGCYC	3 cut(s)	1626, 3439, 6275
BauI	CACGAG	2 cut(s)	316, 2688
BbrPI	CACGTG	2 cut(s)	1076, 2354
BbsI	GAAGAC	4 cut(s)	1501, 2924, 3396, 6540
Bbv12I	GWGCWC	5 cut(s)	1003, 1291, 1626, 2590, 4864
BbvCI	CCTCAGC	2 cut(s)	75, 3885
BceAI	ACGGC	7 cut(s)	251, 345, 1573, 3753, 5498, 5687, 6503
BcgI	CGANNNNNNTGC	2 cut(s)	3107, 3141
BciVI	GTATCC	1 cut(s)	4404
BclI	TGATCA	3 cut(s)	4555, 4903, 5554
BcnI	CCSGG	6 cut(s)	219, 299, 1401, 2742, 3270, 5078
BcoDI	GTCTC	9 cut(s)	618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
BcuI	ACTAGT	1 cut(s)	4466
BfaI	CTAG	8 cut(s)	1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
BfmI	CTRYAG	5 cut(s)	1483, 2418, 2438, 4035, 4137
BfoI	RGCGCY	3 cut(s)	24, 754, 2101
BfrI	CTTAAG	4 cut(s)	1088, 3416, 4739, 4976
BfuAI	ACCTGC	4 cut(s)	2431, 2992, 3172, 4039
BfuI	GTATCC	1 cut(s)	4404
BglI	GCCNNNNNGGC	3 cut(s)	286, 5539, 6079
BglII	AGATCT	2 cut(s)	916, 4702
BlpI	GCTNAGC	2 cut(s)	104, 1002
BmcAI	AGTACT	3 cut(s)	2510, 3825, 4797
Bme18I	GGWCC	9 cut(s)	48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
BmeT110I	CYCGRG	5 cut(s)	284, 853, 2727, 5327, 5903
BmrI	ACTGGG	4 cut(s)	3024, 5043, 5253, 5511
BmtI	GCTAGC	1 cut(s)	5546
BmuI	ACTGGG	4 cut(s)	3024, 5043, 5253, 5511
BpiI	GAAGAC	4 cut(s)	1501, 2924, 3396, 6540
BplI	GAGNNNNNCTC	4 cut(s)	3107, 3139, 4293, 4325
BpmI	CTGGAG	7 cut(s)	668, 1455, 1701, 3538, 3641, 3864, 5862
Bpu10I	CCTNAGC	6 cut(s)	75, 3255, 3885, 4692, 4923, 6036
Bpu1102I	GCTNAGC	2 cut(s)	104, 1002
Bpu14I	TTCGAA	1 cut(s)	3922
BpuEI	CTTGAG	6 cut(s)	767, 1208, 1610, 2330, 4349, 5477
BpuMI	CCSGG	6 cut(s)	219, 299, 1401, 2742, 3270, 5078
BsaAI	YACGTR	3 cut(s)	1076, 2354, 6218
BsaBI	GATNNNNATC	2 cut(s)	3037, 5898
BsaI	GGTCTC	2 cut(s)	2150, 3602
BsaWI	WCCGGW	3 cut(s)	45, 249, 347
BsaXI	ACNNNNNCTCC	8 cut(s)	438, 468, 709, 739, 1909, 1939, 2782, 2812
Bse118I	RCCGGY	1 cut(s)	6444
Bse21I	CCTNAGG	1 cut(s)	4874
Bse3DI	GCAATG	8 cut(s)	931, 3027, 3066, 3312, 3994, 4186, 4354, 6318
Bse8I	GATNNNNATC	2 cut(s)	3037, 5898
BseAI	TCCGGA	2 cut(s)	45, 249
BseJI	GATNNNNATC	2 cut(s)	3037, 5898
BseMI	GCAATG	8 cut(s)	931, 3027, 3066, 3312, 3994, 4186, 4354, 6318
BseRI	GAGGAG	7 cut(s)	426, 2168, 3181, 3902, 4895, 5315, 6293
BseSI	GKGCMC	3 cut(s)	2590, 4864, 6058
BseX3I	CGGCCG	1 cut(s)	220
BseYI	CCCAGC	7 cut(s)	523, 986, 990, 3578, 5368, 5537, 6434
BsgI	GTGCAG	7 cut(s)	179, 2412, 2769, 3735, 4041, 4305, 6483
Bsh1236I	CGCG	2 cut(s)	2187, 2320
Bsh1285I	CGRYCG	2 cut(s)	223, 1400
BshNI	GGYRCC	7 cut(s)	1663, 1744, 3548, 3739, 4460, 5476, 6055
BsiEI	CGRYCG	2 cut(s)	223, 1400
BsiHKAI	GWGCWC	5 cut(s)	1003, 1291, 1626, 2590, 4864
BsiHKCI	CYCGRG	5 cut(s)	284, 853, 2727, 5327, 5903
BslFI	GGGAC	9 cut(s)	175, 201, 1095, 3360, 4663, 5020, 5825, 6216, 6498
BsmAI	GTCTC	9 cut(s)	618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
BsmBI	CGTCTC	1 cut(s)	2030
BsmFI	GGGAC	9 cut(s)	175, 201, 1095, 3360, 4663, 5020, 5825, 6216, 6498
BsmI	GAATGC	3 cut(s)	2538, 3427, 3580
Bso31I	GGTCTC	2 cut(s)	2150, 3602
BsoBI	CYCGRG	5 cut(s)	284, 853, 2727, 5327, 5903
Bsp119I	TTCGAA	1 cut(s)	3922
Bsp1286I	GDGCHC	8 cut(s)	1003, 1291, 1626, 2590, 3439, 4864, 6058, 6275
Bsp13I	TCCGGA	2 cut(s)	45, 249
Bsp1407I	TGTACA	2 cut(s)	759, 2372
Bsp1720I	GCTNAGC	2 cut(s)	104, 1002
Bsp19I	CCATGG	5 cut(s)	1322, 1732, 3587, 4084, 5998
BspEI	TCCGGA	2 cut(s)	45, 249
BspFNI	CGCG	2 cut(s)	2187, 2320
BspHI	TCATGA	4 cut(s)	1648, 3370, 3409, 4213
BspMAI	CTGCAG	3 cut(s)	1487, 2442, 4039
BspMI	ACCTGC	4 cut(s)	2431, 2992, 3172, 4039
BspOI	GCTAGC	1 cut(s)	5546
BspQI	GCTCTTC	1 cut(s)	4155
BspT104I	TTCGAA	1 cut(s)	3922
BspT107I	GGYRCC	7 cut(s)	1663, 1744, 3548, 3739, 4460, 5476, 6055
BspTI	CTTAAG	4 cut(s)	1088, 3416, 4739, 4976
BspTNI	GGTCTC	2 cut(s)	2150, 3602
BsrBI	CCGCTC	2 cut(s)	225, 283
BsrDI	GCAATG	8 cut(s)	931, 3027, 3066, 3312, 3994, 4186, 4354, 6318
BsrFI	RCCGGY	1 cut(s)	6444
BsrGI	TGTACA	2 cut(s)	759, 2372
BssAI	RCCGGY	1 cut(s)	6444
BssSI	CACGAG	2 cut(s)	316, 2688
Bst2BI	CACGAG	2 cut(s)	316, 2688
Bst6I	CTCTTC	6 cut(s)	3144, 3679, 3714, 4155, 4932, 5036
BstAFI	CTTAAG	4 cut(s)	1088, 3416, 4739, 4976
BstAPI	GCANNNNNTGC	1 cut(s)	6119
BstAUI	TGTACA	2 cut(s)	759, 2372
BstBAI	YACGTR	3 cut(s)	1076, 2354, 6218
BstBI	TTCGAA	1 cut(s)	3922
BstDSI	CCRYGG	7 cut(s)	1322, 1732, 2926, 3587, 4084, 5480, 5998
BstEII	GGTNACC	1 cut(s)	4219
BstENI	CCTNNNNNAGG	5 cut(s)	2164, 4877, 5379, 5762, 6521
BstFNI	CGCG	2 cut(s)	2187, 2320
BstH2I	RGCGCY	3 cut(s)	24, 754, 2101
BstHHI	GCGC	5 cut(s)	23, 753, 2100, 2316, 5798
BstMAI	GTCTC	9 cut(s)	618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
BstMCI	CGRYCG	2 cut(s)	223, 1400
BstNSI	RCATGY	5 cut(s)	259, 420, 3509, 3860, 6113
BstPI	GGTNACC	1 cut(s)	4219
BstSFI	CTRYAG	5 cut(s)	1483, 2418, 2438, 4035, 4137
BstSLI	GKGCMC	3 cut(s)	2590, 4864, 6058
BstUI	CGCG	2 cut(s)	2187, 2320
BstV2I	GAAGAC	4 cut(s)	1501, 2924, 3396, 6540
BstXI	CCANNNNNNTGG	2 cut(s)	3665, 4298
BstZI	CGGCCG	1 cut(s)	220
Bsu36I	CCTNAGG	1 cut(s)	4874
BsuI	GTATCC	1 cut(s)	4404
BtgI	CCRYGG	7 cut(s)	1322, 1732, 2926, 3587, 4084, 5480, 5998
BtgZI	GCGATG	1 cut(s)	317
BtsI	GCAGTG	2 cut(s)	117, 3333
BveI	ACCTGC	4 cut(s)	2431, 2992, 3172, 4039
CaiI	CAGNNNCTG	3 cut(s)	695, 2756, 4055
CciI	TCATGA	4 cut(s)	1648, 3370, 3409, 4213
CfoI	GCGC	5 cut(s)	23, 753, 2100, 2316, 5798
Cfr10I	RCCGGY	1 cut(s)	6444
CseI	GACGC	3 cut(s)	1368, 3436, 4754
CsiI	ACCWGGT	1 cut(s)	5170
CspCI	CAANNNNNGTGG	6 cut(s)	2116, 2151, 2908, 2943, 6396, 6431
DraI	TTTAAA	3 cut(s)	2944, 3930, 5001
DraIII	CACNNNGTG	2 cut(s)	5247, 5378
DrdI	GACNNNNNNGTC	1 cut(s)	4433
DseDI	GACNNNNNNGTC	1 cut(s)	4433
EagI	CGGCCG	1 cut(s)	220
Eam1104I	CTCTTC	6 cut(s)	3144, 3679, 3714, 4155, 4932, 5036
EarI	CTCTTC	6 cut(s)	3144, 3679, 3714, 4155, 4932, 5036
EciI	GGCGGA	1 cut(s)	353
Ecl136II	GAGCTC	1 cut(s)	1624
EclXI	CGGCCG	1 cut(s)	220
Eco24I	GRGCYC	3 cut(s)	1626, 3439, 6275
Eco31I	GGTCTC	2 cut(s)	2150, 3602
Eco32I	GATATC	2 cut(s)	2562, 3376
Eco47I	GGWCC	9 cut(s)	48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
Eco52I	CGGCCG	1 cut(s)	220
Eco53kI	GAGCTC	1 cut(s)	1624
Eco72I	CACGTG	2 cut(s)	1076, 2354
Eco81I	CCTNAGG	1 cut(s)	4874
Eco88I	CYCGRG	5 cut(s)	284, 853, 2727, 5327, 5903
Eco91I	GGTNACC	1 cut(s)	4219
EcoICRI	GAGCTC	1 cut(s)	1624
EcoNI	CCTNNNNNAGG	5 cut(s)	2164, 4877, 5379, 5762, 6521
EcoO109I	RGGNCCY	2 cut(s)	2039, 5812
EcoO65I	GGTNACC	1 cut(s)	4219
EcoRI	GAATTC	2 cut(s)	673, 3328
EcoRV	GATATC	2 cut(s)	2562, 3376
EcoT22I	ATGCAT	1 cut(s)	4966
EcoT38I	GRGCYC	3 cut(s)	1626, 3439, 6275
Esp3I	CGTCTC	1 cut(s)	2030
FaqI	GGGAC	9 cut(s)	175, 201, 1095, 3360, 4663, 5020, 5825, 6216, 6498
FauI	CCCGC	2 cut(s)	231, 5667
FauNDI	CATATG	1 cut(s)	839
FbaI	TGATCA	3 cut(s)	4555, 4903, 5554
FriOI	GRGCYC	3 cut(s)	1626, 3439, 6275
FspBI	CTAG	8 cut(s)	1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
GlaI	GCGC	5 cut(s)	22, 752, 2099, 2315, 5797
GsaI	CCCAGC	7 cut(s)	527, 990, 994, 3582, 5372, 5541, 6438
GsuI	CTGGAG	7 cut(s)	668, 1455, 1701, 3538, 3641, 3864, 5862
HaeII	RGCGCY	3 cut(s)	24, 754, 2101
HgaI	GACGC	3 cut(s)	1368, 3436, 4754
HhaI	GCGC	5 cut(s)	23, 753, 2100, 2316, 5798
Hin6I	GCGC	5 cut(s)	21, 751, 2098, 2314, 5796
HinP1I	GCGC	5 cut(s)	21, 751, 2098, 2314, 5796
HincII	GTYRAC	5 cut(s)	1060, 3967, 5680, 5704, 6508
HindII	GTYRAC	5 cut(s)	1060, 3967, 5680, 5704, 6508
HindIII	AAGCTT	5 cut(s)	1877, 2601, 2837, 4777, 5884
HpaI	GTTAAC	2 cut(s)	1060, 5680
Hpy99I	CGWCG	1 cut(s)	215
HpyCH4IV	ACGT	9 cut(s)	1075, 1413, 2134, 2353, 4228, 4356, 4650, 5200, 6217
HpySE526I	ACGT	9 cut(s)	1075, 1413, 2134, 2353, 4228, 4356, 4650, 5200, 6217
HspAI	GCGC	5 cut(s)	21, 751, 2098, 2314, 5796
Kpn2I	TCCGGA	2 cut(s)	45, 249
KroI	GCCGGC	1 cut(s)	6444
KroNI	GCCGGC	1 cut(s)	6446
Ksp22I	TGATCA	3 cut(s)	4555, 4903, 5554
KspAI	GTTAAC	2 cut(s)	1060, 5680
LguI	GCTCTTC	1 cut(s)	4155
MabI	ACCWGGT	1 cut(s)	5170
MaeI	CTAG	8 cut(s)	1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
MaeII	ACGT	9 cut(s)	1075, 1413, 2134, 2353, 4228, 4356, 4650, 5200, 6217
MbiI	CCGCTC	2 cut(s)	225, 283
MfeI	CAATTG	3 cut(s)	1140, 1929, 3384
MhlI	GDGCHC	8 cut(s)	1003, 1291, 1626, 2590, 3439, 4864, 6058, 6275
MlsI	TGGCCA	8 cut(s)	621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MluNI	TGGCCA	8 cut(s)	621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MlyI	GAGTC	7 cut(s)	308, 577, 620, 1386, 1737, 4729, 5316
Mox20I	TGGCCA	8 cut(s)	621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
Mph1103I	ATGCAT	1 cut(s)	4966
MroI	TCCGGA	2 cut(s)	45, 249
MroNI	GCCGGC	1 cut(s)	6444
MroXI	GAANNNNTTC	5 cut(s)	152, 155, 775, 4245, 5734
MscI	TGGCCA	8 cut(s)	621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MslI	CAYNNNNRTG	9 cut(s)	421, 819, 1961, 2216, 2706, 2814, 3071, 3767, 4563
Msp20I	TGGCCA	8 cut(s)	621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MspA1I	CMGCKG	5 cut(s)	523, 880, 895, 990, 6497
MspCI	CTTAAG	4 cut(s)	1088, 3416, 4739, 4976
MunI	CAATTG	3 cut(s)	1140, 1929, 3384
Mva1269I	GAATGC	3 cut(s)	2538, 3427, 3580
MvnI	CGCG	2 cut(s)	2187, 2320
NaeI	GCCGGC	1 cut(s)	6446
NciI	CCSGG	6 cut(s)	219, 299, 1401, 2742, 3270, 5078
NcoI	CCATGG	5 cut(s)	1322, 1732, 3587, 4084, 5998
NdeI	CATATG	1 cut(s)	839
NgoMIV	GCCGGC	1 cut(s)	6444
NheI	GCTAGC	1 cut(s)	5542
NmeAIII	GCCGAG	3 cut(s)	634, 2371, 5716
NmuCI	GTSAC	9 cut(s)	1414, 1954, 3293, 3906, 4219, 4340, 5581, 5960, 6365
NsiI	ATGCAT	1 cut(s)	4966
NspI	RCATGY	5 cut(s)	259, 420, 3509, 3860, 6113
NspV	TTCGAA	1 cut(s)	3922
OliI	CACNNNNGTG	1 cut(s)	2216
PaeI	GCATGC	2 cut(s)	3509, 6113
PaeR7I	CTCGAG	3 cut(s)	853, 5327, 5903
PagI	TCATGA	4 cut(s)	1648, 3370, 3409, 4213
PasI	CCCWGGG	1 cut(s)	3431
PciI	ACATGT	1 cut(s)	3856
PciSI	GCTCTTC	1 cut(s)	4155
PcsI	WCGNNNNNNNCGW	3 cut(s)	95, 291, 6091
PctI	GAATGC	3 cut(s)	2538, 3427, 3580
PdiI	GCCGGC	1 cut(s)	6446
PdmI	GAANNNNTTC	5 cut(s)	152, 155, 775, 4245, 5734
PflFI	GACNNNGTC	1 cut(s)	1401
PflMI	CCANNNNNTGG	2 cut(s)	1328, 4090
PleI	GAGTC	7 cut(s)	308, 576, 619, 1386, 1736, 4729, 5316
PmaCI	CACGTG	2 cut(s)	1076, 2354
PmlI	CACGTG	2 cut(s)	1076, 2354
PpsI	GAGTC	7 cut(s)	308, 576, 619, 1386, 1736, 4729, 5316
Ppu21I	YACGTR	3 cut(s)	1076, 2354, 6218
PpuMI	RGGWCCY	2 cut(s)	2039, 5812
PscI	ACATGT	1 cut(s)	3856
PshBI	ATTAAT	1 cut(s)	3404
Psp124BI	GAGCTC	1 cut(s)	1626
Psp1406I	AACGTT	1 cut(s)	4228
Psp5II	RGGWCCY	2 cut(s)	2039, 5812
PspCI	CACGTG	2 cut(s)	1076, 2354
PspEI	GGTNACC	1 cut(s)	4219
PspFI	CCCAGC	7 cut(s)	523, 986, 990, 3578, 5368, 5537, 6434
PspPPI	RGGWCCY	2 cut(s)	2039, 5812
PspXI	VCTCGAGB	1 cut(s)	853
PstI	CTGCAG	3 cut(s)	1487, 2442, 4039
PstNI	CAGNNNCTG	3 cut(s)	695, 2756, 4055
PsyI	GACNNNGTC	1 cut(s)	1401
PvuII	CAGCTG	4 cut(s)	880, 895, 990, 6497
RseI	CAYNNNNRTG	9 cut(s)	421, 819, 1961, 2216, 2706, 2814, 3071, 3767, 4563
SacI	GAGCTC	1 cut(s)	1626
SapI	GCTCTTC	1 cut(s)	4155
ScaI	AGTACT	3 cut(s)	2510, 3825, 4797
SchI	GAGTC	7 cut(s)	308, 577, 620, 1386, 1737, 4729, 5316
SduI	GDGCHC	8 cut(s)	1003, 1291, 1626, 2590, 3439, 4864, 6058, 6275
SexAI	ACCWGGT	1 cut(s)	5170
SfcI	CTRYAG	5 cut(s)	1483, 2418, 2438, 4035, 4137
SfiI	GGCCNNNNNGGCC	1 cut(s)	6079
Sfr274I	CTCGAG	3 cut(s)	853, 5327, 5903
SfuI	TTCGAA	1 cut(s)	3922
SinI	GGWCC	9 cut(s)	48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
SlaI	CTCGAG	3 cut(s)	853, 5327, 5903
SmiMI	CAYNNNNRTG	9 cut(s)	421, 819, 1961, 2216, 2706, 2814, 3071, 3767, 4563
SpeI	ACTAGT	1 cut(s)	4466
SphI	GCATGC	2 cut(s)	3509, 6113
SspI	AATATT	3 cut(s)	1301, 1574, 4064
SspMI	CTAG	8 cut(s)	1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
SstI	GAGCTC	1 cut(s)	1626
TaiI	ACGT	9 cut(s)	1078, 1416, 2137, 2356, 4231, 4359, 4653, 5203, 6220
TaqII	GACCGA	1 cut(s)	1967
TauI	GCSGC	7 cut(s)	11, 225, 283, 2873, 3648, 3704, 6583
TseFI	GTSAC	9 cut(s)	1414, 1954, 3293, 3906, 4219, 4340, 5581, 5960, 6365
Tsp45I	GTSAC	9 cut(s)	1414, 1954, 3293, 3906, 4219, 4340, 5581, 5960, 6365
TspGWI	ACGGA	5 cut(s)	22, 49, 389, 782, 2915
Tth111I	GACNNNGTC	1 cut(s)	1401
Van91I	CCANNNNNTGG	2 cut(s)	1328, 4090
Vha464I	CTTAAG	4 cut(s)	1088, 3416, 4739, 4976
VneI	GTGCAC	2 cut(s)	2586, 4860
VpaK11BI	GGWCC	9 cut(s)	48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
VspI	ATTAAT	1 cut(s)	3404
XagI	CCTNNNNNAGG	5 cut(s)	2164, 4877, 5379, 5762, 6521
XapI	RAATTY	6 cut(s)	673, 2939, 3328, 4271, 4670, 4826
XceI	RCATGY	5 cut(s)	259, 420, 3509, 3860, 6113
XcmI	CCANNNNNNNNNTGG	6 cut(s)	629, 2494, 3340, 3677, 4795, 6066
XhoI	CTCGAG	3 cut(s)	853, 5327, 5903
XmnI	GAANNNNTTC	5 cut(s)	152, 155, 775, 4245, 5734
XspI	CTAG	8 cut(s)	1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
ZrmI	AGTACT	3 cut(s)	2510, 3825, 4797
Zsp2I	ATGCAT	1 cut(s)	4966

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.