Rmu_ssc0000032.1_g000001

glutamate synthase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000032.1
Physical Location & Seq
Reverse (-)
190 .. 10410
10221 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000032.1_g000001.1.cds

Sequence Viewer

Length: 6630 bp
atgttggcggcgagttccggcgctggtggttccgttctccaactccggaccaaaccttccgtcctcgcttcacctcagctcaatgcctcgccgatagcgaggctaagcaccagagccactgctcgctctggttccaaagctattgcgaagaagttcttcgggacgagattgagggctgccggatccgacaggctgcacttatggcgatccgacggtcccggccgctcgccgaagctgcgggtggtggtccggaacatgctctctgccgtgccggagaagccgctcgggctatacgacccggcgatggataaggactcgtgcggtgttggcttcgtggcggaattgtccggtgaaagcagccgtaaaacgattacggatgctctggaaatgttggtgcggatgacacacagaggagcatgtggatgtgaaacaaacactggtgatggagctggtgttcttgtggcgattcctcacgatttctataaggaggctgccaaagacaatgggtttgagcttccaccgctgggtgagtatgctgttggtatgctctacttgcctacatcggagagtcgtagagaggaaagcaaaaatgtgtttacaaaggttgccgagtctcttggccatactgttcttgggtggcgatcagttcccactgataactcagatttggggaattctgctctccagacagaacctgttattgagcaagtgttccttactccaactccgaggtcgaaagttgatcttgagcgccagatgtacatacttagaagggtttcaatggttgccatccgtgctgcattaaaccttcaacatggtggtgctaaagatttctacatatgttcactttcctcgaggacgattgtttacaagggtcagctgaaacccgaacagctgaagggttactattatgcagatcttggcaatgaaaggtttacgagctacatggccctggtacattctcgattctcaacaaatacttttcccagctgggatcgtgctcagcccatgcgtgtcattggccacaatggagaaatcaacacccttagaggaaatgttaactggatgaaggcacgtgagggactgcttaagtgtactgaacttggtttatcaaaaaatgagttaaagaagctgttaccaattgtggatgccagttcatccgattcaggagcttttgatggtgtccttgagcttctagttcgagctggcagaagcctccctgaagctattatgatgatgattcctgaagcatggcaaaatgacaaaaacatggatcctgataggagagcactgtatgaatatttctcatctctcatggagccatgggatgggccagctctaatatcatttactgatggacgctatctgggagctacattggatcggaatggactccgaccgggtcgcttttacgtcacccacagtggacgagttattatggccagtgaagttggggttgtagatgtacctccagaagatgtctgcaggaaaggaagacttaaccctggaatgatgcttttggtggattttgagaatcatatagtggtagatgatgaagccttgaagcagcaatattcactggcaaggccgtatggggagtggcttaaaaggcagaagattgagctcaaggacatagttgattctgttcatgaatctgacagggtgcctccatccatagctggagttgttcctgcatctactgatgatgacaacatggaaaacatgggagtccatggtttactggcaccactgaaggcttttggttacacagttgaagccttggaaatgttgttgcttcctatggcaaaagatggtgtagaggctcttgggtcaatgggaaatgatacccccttggctgttatgtccaatagagaaaagcttacatttgagtatttcaagcaaatgtttgcccaagtaacaaaccctccaattgatccaattcgagaaaaggtagtcacatctatggaatgtatgatcggtccagaaggtgatctaacagaaaccactgaagaacaatgccatcgtctctcactcaaaggtcctcttttaagcattgaggaaatggaggcaatcaaaaaaatgaattacagaggttggcgctgtaaggttcttgacataacttactccaaggaacgtggtagaaagggattggaggagaccttggataggatctgtgctgaagcacgcgaggcaattaaaaagggatataccacactggtgctttcagacagagccttctccccaaaatgtgttgctgtaagctcactcttggctgttggtgctgttcatcaacatctagttaaaaatcttgagcgcacgcgagtagggttgataattgaatctgccgagccacgtgaggtacaccatttctgtacattagttggattcggtgcagatgccatctgcccctacctggctgtagaggctatttggagactgcaggttgatggaaagatcccaccaaaatctaatggtacaatatattccaaggatgaactggttaaaaagtacttcaaagcaagcaactatggaatgcagaaggttcttgccaagatggggatatctactttggcctcttacaagggtgcacagatttttgaagctttgggtctttcatctgaagtgattgagaggtgctttgcaggaactcctagtagagttgagggggcaacatttgagatgcttgctcgtgatggacttcatctgcatgatttggcatttccttctcgggcttttcctccgggtagtgcagaagctgtggcactaccaaatccaggggattatcattggagaaaaggtggtgaagttcacctaaatgatccttttgctatttccaagcttcaggaggctgccagaactaacagtgtggcggcatataaagaatactccaagctcattcatcaattaaataaagcctgcaatctccgtggtcttctgaaatttaaaaacacagagcagcaaattgacttggatgaagtggaacctgccagtgaaattgttaaacggttctgtactggggcaatgagttatggatcaatatcattggaggcacacactacactggccattgctatgaacagaatgggaggaaagtcaaatacaggtgagggaggtgagcagccctctcgtatggagcctcttcctgatggttcaaggaatccaaagaggagtgcaattaagcaggttgcaagtgggagatttggagtttcaagttactatcttacaaatgctgatgaactccaaataaaaatggctcagggggccaagcccggtgaaggaggtgagcttcctggtcacaaggttattggagacattgctgttaccaggaattccactgctggtgtgggacttatcagcccacctccccatcatgatatctactcaattgaagaccttgctcaattaattcatgatcttaagaatgctaacccaggggctcgaataagcgtcaagttagtgtctgaagctggtgtaggagtagttgctagtggagttgtgaaggggcatgctgaccatgttttaattgccggacatgatggaggcactggtgcctccagatggactggcattaagaatgctgggcttccatgggaacttggcttggctgagacccatcaaaccctggttgctaatgatcttcgtggccgcacagttctccagacagatggccaactaaaaactggaagagatgtggccatagccgcacttcttggtgcagaagagtttgggttcagcacggcacccctcataacccttggctgcattatgatgcggaagtgccacaagaacacctgtcctgtcggaattgcaacccaagatccagtacttcgtgagaagtttgctggagaacctgaacatgttatcaactttttcttcatggtagctgaggaggtgagagagataatgtcacaacttggttttcgaactttaaatgaaatggttggtcgttcagatatgcttgaagttgacaaagaagttactaaaggcaatgagaagctggacaacattgatctttccctgttacttagacctgctgcagacattcggccagaagctgcacaatattgtgttcagaaacaggaccatgggttggacatggctcttgaccacaaacttatttcgctgtccagttctgctatagagaaggctcttcctgcatactttgaaacaccgatttgcaatgtgaatcgtgctgttggaacaatgcttagtcatgaggtgaccaaacgttacaacagggaagggcttccagcagacaccattcatatcaaattcattggaagtgcaggccagagccttggagctttcctctgccctggcatcacacttgagcttgaaggtgacagcaatgattacgttggtaaaggattgtctggtggcaagatcgtagtgtatccccccaagggaagcaagtttgacccgaaagacaacattgtcattggtaatgtagctctttatggtgccactagtggggaggcatatttcaatggaatggcagcagaaagattctgtgttcgcaattcaggggcaagggcagtagttgaaggtgtcggtgatcatggctgtgagtacatgacaggtggcactgttgttgtgcttgggaaaactggcaggaactttgctgctggtatgagtggtggcatagcctacgttcttgatgtggatggaaaatttttgtcccgatgcaatcctgagcttgtagatcttgataaagttgaaggagaagatagtatgactcttaagatgatgatacagcagcatcagcgtcatacaaaaagcttgctggccagtgaagtactggctgattttgagaatcttttgcctaaattcatcaaggttatccccagagagtacaagcgtgcacttgcaaacctgagggaggaggccaccaaacaggcagttgatcaagctgatgaagaagctcaggagcaagaggaagaggtggaaataaaggggaaagatgcatttgaagaacttaagaagatggcatctgcatctttaaatgggacatccaatcaggtagaagatgctgaaacattgaagaggcccagtgaggtcagcaaagctgttaaacaccggggtttcatttcttatgagcgtgagggcgttcaatacagggatcccaaagttcggatgaatgactggaaggaagttatggaggaaactaaacctggtccacttgtgaatacacagtcagcacgttgcatggactgtggcactcctttctgccatcaggaaaacactgggtgtcctcttggtaacaaaatacctgagttcaatgaattggtgtaccagaataggtggcatgaagcattagagagactcctcgagacaaataacttccctgagtttactggtcgagtttgcccagcaccttgtgaaggttcatgtgttctgggtattattgagaatcctgtctctattaaaagcattgaatgtgccatcatagacaaggcttttgaggaaggttggatggtgccacggcctccactcaagagaactgggaaaaaggttgccattgtcggaagtgggcctgctgggctagctgctgctgatcaactaaacagaataggtcatacagtgacagtttacgagcgtgctgatagaattggagggctgatgatgtatggagtgcctaatatgaaggctgacaaagttgatatagttcaacggcgggttaaccttatggccgaggaaggtgtcaactttgtggtcaatgctaatgttggaaatgattcttcctactcgtttgatcgccttcgggaggataacaatgcgattattttagcagtaggcgcaacgaagccaagggaccttcccgtacctgggcgagagctgtctggagtacatttcgctatggagtttcttcatgcaaacaccaaaagcttgcttgatagcaatctcgagaatggtaactatatttctgccaagggtaagaaggttgtggtcattggtggaggtgacactggcactgattgtattggaacctctgttcgccatggctgtactaacattgttaatttggagcttctccctgagccaccacgaacaagggcaccaggaaacccttggccacagtggcctcgtatattccgagtagattatgggcatgcagaagttgcagccaagtttggcaaagatccaagaacttatgaggtgctgactaagaggtttgtgggagatgagaatggggttgtgaagggactagaggtagtacgtgtcaaatgggagaaggatgctactggcaagttccaatttaaggaaatcgagggctctgaggagataattgaggccgatctcgtccttctagcaatggggttccttggacctgaagcggtgattgcagagaagttgggcttggagcgtgacaatcgctcaaacttcaaggcagattatggtcggttctcaaccaatgtggatggggtctttgctgctggggattgccggcgtggtcaatccctggtggtgtgggcaatctcagagggacggcaagcagctgcacaggttgacaactacctctgcaaggaagaagaagaccacacaaacagcaacgggatccctgaatccgatctattgaagcggcatcaagaaatcagcaagagccataagacagttgcaagcacaccatag

Protein Analysis

2209

Amino Acids

241.88

Weight (kDa)

6.21

Isoelectric Point (pI)

34.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 4433
AbsI CCTCGAGG 1 cut(s) 853
Acc36I ACCTGC 4 cut(s) 2431, 2992, 3172, 4039
AccB1I GGYRCC 7 cut(s) 1663, 1744, 3548, 3739, 4460, 5476, 6055
AccB7I CCANNNNNTGG 2 cut(s) 1328, 4090
AccBSI CCGCTC 2 cut(s) 225, 283
AccII CGCG 2 cut(s) 2187, 2320
AccIII TCCGGA 2 cut(s) 45, 249
AclI AACGTT 1 cut(s) 4228
AcsI RAATTY 6 cut(s) 673, 2939, 3328, 4271, 4670, 4826
AcvI CACGTG 2 cut(s) 1076, 2354
AdeI CACNNNGTG 2 cut(s) 5247, 5378
AflII CTTAAG 4 cut(s) 1088, 3416, 4739, 4976
AflIII ACRYGT 2 cut(s) 3856, 6217
AhlI ACTAGT 1 cut(s) 4466
AjuI GAANNNNNNNTTGG 2 cut(s) 6341, 6373
AleI CACNNNNGTG 1 cut(s) 2216
AloI GAACNNNNNNTCC 4 cut(s) 438, 470, 5976, 6008
Alw21I GWGCWC 5 cut(s) 1003, 1291, 1626, 2590, 4864
Alw26I GTCTC 9 cut(s) 618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
Alw44I GTGCAC 2 cut(s) 2586, 4860
AlwNI CAGNNNCTG 3 cut(s) 695, 2756, 4055
Ama87I CYCGRG 5 cut(s) 284, 853, 2727, 5327, 5903
Aor13HI TCCGGA 2 cut(s) 45, 249
ApaLI GTGCAC 2 cut(s) 2586, 4860
ApoI RAATTY 6 cut(s) 673, 2939, 3328, 4271, 4670, 4826
ArsI GACNNNNNNTTYG 6 cut(s) 45, 77, 491, 523, 5441, 5473
AseI ATTAAT 1 cut(s) 3404
Asp700I GAANNNNTTC 5 cut(s) 152, 155, 775, 4245, 5734
AspLEI GCGC 5 cut(s) 23, 753, 2100, 2316, 5798
AsuC2I CCSGG 6 cut(s) 219, 299, 1401, 2742, 3270, 5078
AsuII TTCGAA 1 cut(s) 3922
AsuNHI GCTAGC 1 cut(s) 5542
AvaI CYCGRG 5 cut(s) 284, 853, 2727, 5327, 5903
AvaII GGWCC 9 cut(s) 48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
AxyI CCTNAGG 1 cut(s) 4874
BaeGI GKGCMC 3 cut(s) 2590, 4864, 6058
BalI TGGCCA 8 cut(s) 621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
BamHI GGATCC 4 cut(s) 182, 1273, 5119, 6555
BanI GGYRCC 7 cut(s) 1663, 1744, 3548, 3739, 4460, 5476, 6055
BanII GRGCYC 3 cut(s) 1626, 3439, 6275
BauI CACGAG 2 cut(s) 316, 2688
BbrPI CACGTG 2 cut(s) 1076, 2354
BbsI GAAGAC 4 cut(s) 1501, 2924, 3396, 6540
Bbv12I GWGCWC 5 cut(s) 1003, 1291, 1626, 2590, 4864
BbvCI CCTCAGC 2 cut(s) 75, 3885
BceAI ACGGC 7 cut(s) 251, 345, 1573, 3753, 5498, 5687, 6503
BcgI CGANNNNNNTGC 2 cut(s) 3107, 3141
BciVI GTATCC 1 cut(s) 4404
BclI TGATCA 3 cut(s) 4555, 4903, 5554
BcnI CCSGG 6 cut(s) 219, 299, 1401, 2742, 3270, 5078
BcoDI GTCTC 9 cut(s) 618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
BcuI ACTAGT 1 cut(s) 4466
BfaI CTAG 8 cut(s) 1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
BfmI CTRYAG 5 cut(s) 1483, 2418, 2438, 4035, 4137
BfoI RGCGCY 3 cut(s) 24, 754, 2101
BfrI CTTAAG 4 cut(s) 1088, 3416, 4739, 4976
BfuAI ACCTGC 4 cut(s) 2431, 2992, 3172, 4039
BfuI GTATCC 1 cut(s) 4404
BglI GCCNNNNNGGC 3 cut(s) 286, 5539, 6079
BglII AGATCT 2 cut(s) 916, 4702
BlpI GCTNAGC 2 cut(s) 104, 1002
BmcAI AGTACT 3 cut(s) 2510, 3825, 4797
Bme18I GGWCC 9 cut(s) 48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
BmeT110I CYCGRG 5 cut(s) 284, 853, 2727, 5327, 5903
BmrI ACTGGG 4 cut(s) 3024, 5043, 5253, 5511
BmtI GCTAGC 1 cut(s) 5546
BmuI ACTGGG 4 cut(s) 3024, 5043, 5253, 5511
BpiI GAAGAC 4 cut(s) 1501, 2924, 3396, 6540
BplI GAGNNNNNCTC 4 cut(s) 3107, 3139, 4293, 4325
BpmI CTGGAG 7 cut(s) 668, 1455, 1701, 3538, 3641, 3864, 5862
Bpu10I CCTNAGC 6 cut(s) 75, 3255, 3885, 4692, 4923, 6036
Bpu1102I GCTNAGC 2 cut(s) 104, 1002
Bpu14I TTCGAA 1 cut(s) 3922
BpuEI CTTGAG 6 cut(s) 767, 1208, 1610, 2330, 4349, 5477
BpuMI CCSGG 6 cut(s) 219, 299, 1401, 2742, 3270, 5078
BsaAI YACGTR 3 cut(s) 1076, 2354, 6218
BsaBI GATNNNNATC 2 cut(s) 3037, 5898
BsaI GGTCTC 2 cut(s) 2150, 3602
BsaWI WCCGGW 3 cut(s) 45, 249, 347
BsaXI ACNNNNNCTCC 8 cut(s) 438, 468, 709, 739, 1909, 1939, 2782, 2812
Bse118I RCCGGY 1 cut(s) 6444
Bse21I CCTNAGG 1 cut(s) 4874
Bse3DI GCAATG 8 cut(s) 931, 3027, 3066, 3312, 3994, 4186, 4354, 6318
Bse8I GATNNNNATC 2 cut(s) 3037, 5898
BseAI TCCGGA 2 cut(s) 45, 249
BseJI GATNNNNATC 2 cut(s) 3037, 5898
BseMI GCAATG 8 cut(s) 931, 3027, 3066, 3312, 3994, 4186, 4354, 6318
BseRI GAGGAG 7 cut(s) 426, 2168, 3181, 3902, 4895, 5315, 6293
BseSI GKGCMC 3 cut(s) 2590, 4864, 6058
BseX3I CGGCCG 1 cut(s) 220
BseYI CCCAGC 7 cut(s) 523, 986, 990, 3578, 5368, 5537, 6434
BsgI GTGCAG 7 cut(s) 179, 2412, 2769, 3735, 4041, 4305, 6483
Bsh1236I CGCG 2 cut(s) 2187, 2320
Bsh1285I CGRYCG 2 cut(s) 223, 1400
BshNI GGYRCC 7 cut(s) 1663, 1744, 3548, 3739, 4460, 5476, 6055
BsiEI CGRYCG 2 cut(s) 223, 1400
BsiHKAI GWGCWC 5 cut(s) 1003, 1291, 1626, 2590, 4864
BsiHKCI CYCGRG 5 cut(s) 284, 853, 2727, 5327, 5903
BslFI GGGAC 9 cut(s) 175, 201, 1095, 3360, 4663, 5020, 5825, 6216, 6498
BsmAI GTCTC 9 cut(s) 618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
BsmBI CGTCTC 1 cut(s) 2030
BsmFI GGGAC 9 cut(s) 175, 201, 1095, 3360, 4663, 5020, 5825, 6216, 6498
BsmI GAATGC 3 cut(s) 2538, 3427, 3580
Bso31I GGTCTC 2 cut(s) 2150, 3602
BsoBI CYCGRG 5 cut(s) 284, 853, 2727, 5327, 5903
Bsp119I TTCGAA 1 cut(s) 3922
Bsp1286I GDGCHC 8 cut(s) 1003, 1291, 1626, 2590, 3439, 4864, 6058, 6275
Bsp13I TCCGGA 2 cut(s) 45, 249
Bsp1407I TGTACA 2 cut(s) 759, 2372
Bsp1720I GCTNAGC 2 cut(s) 104, 1002
Bsp19I CCATGG 5 cut(s) 1322, 1732, 3587, 4084, 5998
BspEI TCCGGA 2 cut(s) 45, 249
BspFNI CGCG 2 cut(s) 2187, 2320
BspHI TCATGA 4 cut(s) 1648, 3370, 3409, 4213
BspMAI CTGCAG 3 cut(s) 1487, 2442, 4039
BspMI ACCTGC 4 cut(s) 2431, 2992, 3172, 4039
BspOI GCTAGC 1 cut(s) 5546
BspQI GCTCTTC 1 cut(s) 4155
BspT104I TTCGAA 1 cut(s) 3922
BspT107I GGYRCC 7 cut(s) 1663, 1744, 3548, 3739, 4460, 5476, 6055
BspTI CTTAAG 4 cut(s) 1088, 3416, 4739, 4976
BspTNI GGTCTC 2 cut(s) 2150, 3602
BsrBI CCGCTC 2 cut(s) 225, 283
BsrDI GCAATG 8 cut(s) 931, 3027, 3066, 3312, 3994, 4186, 4354, 6318
BsrFI RCCGGY 1 cut(s) 6444
BsrGI TGTACA 2 cut(s) 759, 2372
BssAI RCCGGY 1 cut(s) 6444
BssSI CACGAG 2 cut(s) 316, 2688
Bst2BI CACGAG 2 cut(s) 316, 2688
Bst6I CTCTTC 6 cut(s) 3144, 3679, 3714, 4155, 4932, 5036
BstAFI CTTAAG 4 cut(s) 1088, 3416, 4739, 4976
BstAPI GCANNNNNTGC 1 cut(s) 6119
BstAUI TGTACA 2 cut(s) 759, 2372
BstBAI YACGTR 3 cut(s) 1076, 2354, 6218
BstBI TTCGAA 1 cut(s) 3922
BstDSI CCRYGG 7 cut(s) 1322, 1732, 2926, 3587, 4084, 5480, 5998
BstEII GGTNACC 1 cut(s) 4219
BstENI CCTNNNNNAGG 5 cut(s) 2164, 4877, 5379, 5762, 6521
BstFNI CGCG 2 cut(s) 2187, 2320
BstH2I RGCGCY 3 cut(s) 24, 754, 2101
BstHHI GCGC 5 cut(s) 23, 753, 2100, 2316, 5798
BstMAI GTCTC 9 cut(s) 618, 2030, 2150, 2428, 3303, 3602, 5314, 5324, 5422
BstMCI CGRYCG 2 cut(s) 223, 1400
BstNSI RCATGY 5 cut(s) 259, 420, 3509, 3860, 6113
BstPI GGTNACC 1 cut(s) 4219
BstSFI CTRYAG 5 cut(s) 1483, 2418, 2438, 4035, 4137
BstSLI GKGCMC 3 cut(s) 2590, 4864, 6058
BstUI CGCG 2 cut(s) 2187, 2320
BstV2I GAAGAC 4 cut(s) 1501, 2924, 3396, 6540
BstXI CCANNNNNNTGG 2 cut(s) 3665, 4298
BstZI CGGCCG 1 cut(s) 220
Bsu36I CCTNAGG 1 cut(s) 4874
BsuI GTATCC 1 cut(s) 4404
BtgI CCRYGG 7 cut(s) 1322, 1732, 2926, 3587, 4084, 5480, 5998
BtgZI GCGATG 1 cut(s) 317
BtsI GCAGTG 2 cut(s) 117, 3333
BveI ACCTGC 4 cut(s) 2431, 2992, 3172, 4039
CaiI CAGNNNCTG 3 cut(s) 695, 2756, 4055
CciI TCATGA 4 cut(s) 1648, 3370, 3409, 4213
CfoI GCGC 5 cut(s) 23, 753, 2100, 2316, 5798
Cfr10I RCCGGY 1 cut(s) 6444
CseI GACGC 3 cut(s) 1368, 3436, 4754
CsiI ACCWGGT 1 cut(s) 5170
CspCI CAANNNNNGTGG 6 cut(s) 2116, 2151, 2908, 2943, 6396, 6431
DraI TTTAAA 3 cut(s) 2944, 3930, 5001
DraIII CACNNNGTG 2 cut(s) 5247, 5378
DrdI GACNNNNNNGTC 1 cut(s) 4433
DseDI GACNNNNNNGTC 1 cut(s) 4433
EagI CGGCCG 1 cut(s) 220
Eam1104I CTCTTC 6 cut(s) 3144, 3679, 3714, 4155, 4932, 5036
EarI CTCTTC 6 cut(s) 3144, 3679, 3714, 4155, 4932, 5036
EciI GGCGGA 1 cut(s) 353
Ecl136II GAGCTC 1 cut(s) 1624
EclXI CGGCCG 1 cut(s) 220
Eco24I GRGCYC 3 cut(s) 1626, 3439, 6275
Eco31I GGTCTC 2 cut(s) 2150, 3602
Eco32I GATATC 2 cut(s) 2562, 3376
Eco47I GGWCC 9 cut(s) 48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
Eco52I CGGCCG 1 cut(s) 220
Eco53kI GAGCTC 1 cut(s) 1624
Eco72I CACGTG 2 cut(s) 1076, 2354
Eco81I CCTNAGG 1 cut(s) 4874
Eco88I CYCGRG 5 cut(s) 284, 853, 2727, 5327, 5903
Eco91I GGTNACC 1 cut(s) 4219
EcoICRI GAGCTC 1 cut(s) 1624
EcoNI CCTNNNNNAGG 5 cut(s) 2164, 4877, 5379, 5762, 6521
EcoO109I RGGNCCY 2 cut(s) 2039, 5812
EcoO65I GGTNACC 1 cut(s) 4219
EcoRI GAATTC 2 cut(s) 673, 3328
EcoRV GATATC 2 cut(s) 2562, 3376
EcoT22I ATGCAT 1 cut(s) 4966
EcoT38I GRGCYC 3 cut(s) 1626, 3439, 6275
Esp3I CGTCTC 1 cut(s) 2030
FaqI GGGAC 9 cut(s) 175, 201, 1095, 3360, 4663, 5020, 5825, 6216, 6498
FauI CCCGC 2 cut(s) 231, 5667
FauNDI CATATG 1 cut(s) 839
FbaI TGATCA 3 cut(s) 4555, 4903, 5554
FriOI GRGCYC 3 cut(s) 1626, 3439, 6275
FspBI CTAG 8 cut(s) 1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
GlaI GCGC 5 cut(s) 22, 752, 2099, 2315, 5797
GsaI CCCAGC 7 cut(s) 527, 990, 994, 3582, 5372, 5541, 6438
GsuI CTGGAG 7 cut(s) 668, 1455, 1701, 3538, 3641, 3864, 5862
HaeII RGCGCY 3 cut(s) 24, 754, 2101
HgaI GACGC 3 cut(s) 1368, 3436, 4754
HhaI GCGC 5 cut(s) 23, 753, 2100, 2316, 5798
Hin6I GCGC 5 cut(s) 21, 751, 2098, 2314, 5796
HinP1I GCGC 5 cut(s) 21, 751, 2098, 2314, 5796
HincII GTYRAC 5 cut(s) 1060, 3967, 5680, 5704, 6508
HindII GTYRAC 5 cut(s) 1060, 3967, 5680, 5704, 6508
HindIII AAGCTT 5 cut(s) 1877, 2601, 2837, 4777, 5884
HpaI GTTAAC 2 cut(s) 1060, 5680
Hpy99I CGWCG 1 cut(s) 215
HpyCH4IV ACGT 9 cut(s) 1075, 1413, 2134, 2353, 4228, 4356, 4650, 5200, 6217
HpySE526I ACGT 9 cut(s) 1075, 1413, 2134, 2353, 4228, 4356, 4650, 5200, 6217
HspAI GCGC 5 cut(s) 21, 751, 2098, 2314, 5796
Kpn2I TCCGGA 2 cut(s) 45, 249
KroI GCCGGC 1 cut(s) 6444
KroNI GCCGGC 1 cut(s) 6446
Ksp22I TGATCA 3 cut(s) 4555, 4903, 5554
KspAI GTTAAC 2 cut(s) 1060, 5680
LguI GCTCTTC 1 cut(s) 4155
MabI ACCWGGT 1 cut(s) 5170
MaeI CTAG 8 cut(s) 1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
MaeII ACGT 9 cut(s) 1075, 1413, 2134, 2353, 4228, 4356, 4650, 5200, 6217
MbiI CCGCTC 2 cut(s) 225, 283
MfeI CAATTG 3 cut(s) 1140, 1929, 3384
MhlI GDGCHC 8 cut(s) 1003, 1291, 1626, 2590, 3439, 4864, 6058, 6275
MlsI TGGCCA 8 cut(s) 621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MluNI TGGCCA 8 cut(s) 621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MlyI GAGTC 7 cut(s) 308, 577, 620, 1386, 1737, 4729, 5316
Mox20I TGGCCA 8 cut(s) 621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
Mph1103I ATGCAT 1 cut(s) 4966
MroI TCCGGA 2 cut(s) 45, 249
MroNI GCCGGC 1 cut(s) 6444
MroXI GAANNNNTTC 5 cut(s) 152, 155, 775, 4245, 5734
MscI TGGCCA 8 cut(s) 621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MslI CAYNNNNRTG 9 cut(s) 421, 819, 1961, 2216, 2706, 2814, 3071, 3767, 4563
Msp20I TGGCCA 8 cut(s) 621, 1023, 1442, 3065, 3669, 3695, 4787, 6073
MspA1I CMGCKG 5 cut(s) 523, 880, 895, 990, 6497
MspCI CTTAAG 4 cut(s) 1088, 3416, 4739, 4976
MunI CAATTG 3 cut(s) 1140, 1929, 3384
Mva1269I GAATGC 3 cut(s) 2538, 3427, 3580
MvnI CGCG 2 cut(s) 2187, 2320
NaeI GCCGGC 1 cut(s) 6446
NciI CCSGG 6 cut(s) 219, 299, 1401, 2742, 3270, 5078
NcoI CCATGG 5 cut(s) 1322, 1732, 3587, 4084, 5998
NdeI CATATG 1 cut(s) 839
NgoMIV GCCGGC 1 cut(s) 6444
NheI GCTAGC 1 cut(s) 5542
NmeAIII GCCGAG 3 cut(s) 634, 2371, 5716
NmuCI GTSAC 9 cut(s) 1414, 1954, 3293, 3906, 4219, 4340, 5581, 5960, 6365
NsiI ATGCAT 1 cut(s) 4966
NspI RCATGY 5 cut(s) 259, 420, 3509, 3860, 6113
NspV TTCGAA 1 cut(s) 3922
OliI CACNNNNGTG 1 cut(s) 2216
PaeI GCATGC 2 cut(s) 3509, 6113
PaeR7I CTCGAG 3 cut(s) 853, 5327, 5903
PagI TCATGA 4 cut(s) 1648, 3370, 3409, 4213
PasI CCCWGGG 1 cut(s) 3431
PciI ACATGT 1 cut(s) 3856
PciSI GCTCTTC 1 cut(s) 4155
PcsI WCGNNNNNNNCGW 3 cut(s) 95, 291, 6091
PctI GAATGC 3 cut(s) 2538, 3427, 3580
PdiI GCCGGC 1 cut(s) 6446
PdmI GAANNNNTTC 5 cut(s) 152, 155, 775, 4245, 5734
PflFI GACNNNGTC 1 cut(s) 1401
PflMI CCANNNNNTGG 2 cut(s) 1328, 4090
PleI GAGTC 7 cut(s) 308, 576, 619, 1386, 1736, 4729, 5316
PmaCI CACGTG 2 cut(s) 1076, 2354
PmlI CACGTG 2 cut(s) 1076, 2354
PpsI GAGTC 7 cut(s) 308, 576, 619, 1386, 1736, 4729, 5316
Ppu21I YACGTR 3 cut(s) 1076, 2354, 6218
PpuMI RGGWCCY 2 cut(s) 2039, 5812
PscI ACATGT 1 cut(s) 3856
PshBI ATTAAT 1 cut(s) 3404
Psp124BI GAGCTC 1 cut(s) 1626
Psp1406I AACGTT 1 cut(s) 4228
Psp5II RGGWCCY 2 cut(s) 2039, 5812
PspCI CACGTG 2 cut(s) 1076, 2354
PspEI GGTNACC 1 cut(s) 4219
PspFI CCCAGC 7 cut(s) 523, 986, 990, 3578, 5368, 5537, 6434
PspPPI RGGWCCY 2 cut(s) 2039, 5812
PspXI VCTCGAGB 1 cut(s) 853
PstI CTGCAG 3 cut(s) 1487, 2442, 4039
PstNI CAGNNNCTG 3 cut(s) 695, 2756, 4055
PsyI GACNNNGTC 1 cut(s) 1401
PvuII CAGCTG 4 cut(s) 880, 895, 990, 6497
RseI CAYNNNNRTG 9 cut(s) 421, 819, 1961, 2216, 2706, 2814, 3071, 3767, 4563
SacI GAGCTC 1 cut(s) 1626
SapI GCTCTTC 1 cut(s) 4155
ScaI AGTACT 3 cut(s) 2510, 3825, 4797
SchI GAGTC 7 cut(s) 308, 577, 620, 1386, 1737, 4729, 5316
SduI GDGCHC 8 cut(s) 1003, 1291, 1626, 2590, 3439, 4864, 6058, 6275
SexAI ACCWGGT 1 cut(s) 5170
SfcI CTRYAG 5 cut(s) 1483, 2418, 2438, 4035, 4137
SfiI GGCCNNNNNGGCC 1 cut(s) 6079
Sfr274I CTCGAG 3 cut(s) 853, 5327, 5903
SfuI TTCGAA 1 cut(s) 3922
SinI GGWCC 9 cut(s) 48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
SlaI CTCGAG 3 cut(s) 853, 5327, 5903
SmiMI CAYNNNNRTG 9 cut(s) 421, 819, 1961, 2216, 2706, 2814, 3071, 3767, 4563
SpeI ACTAGT 1 cut(s) 4466
SphI GCATGC 2 cut(s) 3509, 6113
SspI AATATT 3 cut(s) 1301, 1574, 4064
SspMI CTAG 8 cut(s) 1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
SstI GAGCTC 1 cut(s) 1626
TaiI ACGT 9 cut(s) 1078, 1416, 2137, 2356, 4231, 4359, 4653, 5203, 6220
TaqII GACCGA 1 cut(s) 1967
TauI GCSGC 7 cut(s) 11, 225, 283, 2873, 3648, 3704, 6583
TseFI GTSAC 9 cut(s) 1414, 1954, 3293, 3906, 4219, 4340, 5581, 5960, 6365
Tsp45I GTSAC 9 cut(s) 1414, 1954, 3293, 3906, 4219, 4340, 5581, 5960, 6365
TspGWI ACGGA 5 cut(s) 22, 49, 389, 782, 2915
Tth111I GACNNNGTC 1 cut(s) 1401
Van91I CCANNNNNTGG 2 cut(s) 1328, 4090
Vha464I CTTAAG 4 cut(s) 1088, 3416, 4739, 4976
VneI GTGCAC 2 cut(s) 2586, 4860
VpaK11BI GGWCC 9 cut(s) 48, 215, 247, 1979, 2039, 4081, 5174, 5812, 6326
VspI ATTAAT 1 cut(s) 3404
XagI CCTNNNNNAGG 5 cut(s) 2164, 4877, 5379, 5762, 6521
XapI RAATTY 6 cut(s) 673, 2939, 3328, 4271, 4670, 4826
XceI RCATGY 5 cut(s) 259, 420, 3509, 3860, 6113
XcmI CCANNNNNNNNNTGG 6 cut(s) 629, 2494, 3340, 3677, 4795, 6066
XhoI CTCGAG 3 cut(s) 853, 5327, 5903
XmnI GAANNNNTTC 5 cut(s) 152, 155, 775, 4245, 5734
XspI CTAG 8 cut(s) 1196, 2297, 2652, 3486, 4467, 5543, 6206, 6308
ZrmI AGTACT 3 cut(s) 2510, 3825, 4797
Zsp2I ATGCAT 1 cut(s) 4966
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.