Rmu_ssc0000091.1_g000025

Functions in the early steps of protein synthesis of a small number of specific mRNAs. Acts by directing the binding of methionyl-tRNAi to 40S ribosomal subunits. In contrast to the eIF- 2 complex, it binds methionyl-tRNAi to 40 S subunits in a codon- dependent manner, whereas the eIF-2 complex binds methionyl-tRNAi to 40 S subunits in a GTP-dependent manner. May act by impiging the expression of specific proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000091.1
OG0010315
Physical Location & Seq
Reverse (-)
142236 .. 146775
4540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000091.1_g000025.1.cds

Sequence Viewer

Length: 1404 bp
atggtgctcaaacccgattccgtcatcaccatctacgattgccgaagctacgccgagattaggtctttccaagtccccaacctcaccgccgccgccttgtccccgcgcggcacttttcttcagactttccagaagtcctcaacgccgcagaacaagaatgtgaccctgtggaacgtcgacaccggagaacctgcttacgatcaattccagaagagtataaccaaaacgaattggccctcggttaggttcagctccgacgaggctgttgcgtgtaaacttgcgacgaatgagatacagttttttgatgctgcagacttctcgaaaggagttacgaatcggctgagagttcctggagtggctgcaattgaactctctaaggcacctggctcccatgtggctgcatttgtcccggaatcgaaggtttgtaggaacttcttcgggaactatgttttttgttatggtcacattatcaagttcaatattctttccatgcaggggattcctgccagtgtccagatatttgccactggaaaagatttacagagtcaacctgttgctcgaaggagtttctttcgatgttcatcagtgcaactgaattggaataatggctcaactgggcttttagttgtggcacagtcagatgttgataaaaccaaccaaagttactatggggaatcaaaactaaactacttgacaacagatggaacccatgaaggacttgtacctcttcgtaaagaggggcctgttcatgatgttcagtggtcatactctggatcagagtttgctgtagtttatggctgcccgtacaatactatccgatggaatccaaagggaaaatttctgtgtttggcaggctttggtaacttaccaggtgatatggcattttgggactacatagagaaaaagcagcttggaacaaccaaggccgaattatctgtgacaagcgaatggtctccagatggacgctatttcatgactgccacgactgctccaagactacaagttgacaatgggattaagattttccaccacaacggttcattgttcttcaagaagatgtttgacaagctgttccaggctgattggaaaccagaatcacctgataggttcagtgacatttcagaacttgtcaagtcctttgaatcaataaaagttgatgacgccaaacctcaaggagaaaggtccaaatcttcccaaacctctgcaaaagccagccctaacaacccacctgcacaaaagcctgctgcatatcgccccccacatgctaagcaagctgctgtcgttcaggcagagctgtttggagggaccacatcagaaacaatgagcaagaatgcattgcgaaacaagaagaaaagggagaaacaaaaggagaagaaggctaccgagggtgccaatgatagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
eIF2A

Protein Analysis

467

Amino Acids

51.89

Weight (kDa)

9.22

Isoelectric Point (pI)

43.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010315)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G73180 AT1G73180
fragaria_vesca FvH4_1g25500 FvH4_1g25500 FvH4_1g25500 FvH4_1g25500 FvH4_1g25500
malus_domestica MD15G1424000.v1.1
prunus_persica Prupe.1G207000_v2.0.a1
pyrus_communis pycom15g37600
rosa_chinensis RchiOBHm_Chr2g0123631
rosa_laevigata RLG00000018761
rosa_multiflora Rmu_ssc0000091.1_g000025
rosa_roxburghii Rroxscaffold_2G00120520
rosa_rugosa Rorug02G0246500 Rorug02G0246600
rosa_samantha Rh2AG305800 Rh2BG313800 Rh2CG291900 Rh2DG329600
rosa_wichuraiana Rw2G024520

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 1237
Acc36I ACCTGC 2 cut(s) 199, 1237
AccB1I GGYRCC 2 cut(s) 379, 1388
AccI GTMKAC 1 cut(s) 177
AccII CGCG 2 cut(s) 106, 108
AciI CCGC 6 cut(s) 87, 90, 93, 104, 108, 146
AclWI GGATC 1 cut(s) 781
AcsI RAATTY 1 cut(s) 836
AcuI CTGAAG 1 cut(s) 104
AcyI GRCGYC 1 cut(s) 1161
AfaI GTAC 2 cut(s) 723, 806
AfiI CCNNNNNNNGG 3 cut(s) 60, 243, 495
AgsI TTSAA 4 cut(s) 368, 478, 1051, 1142
AjnI CCWGG 4 cut(s) 349, 382, 868, 1074
AluBI AGCT 6 cut(s) 48, 252, 910, 1069, 1274, 1294
AluI AGCT 6 cut(s) 48, 252, 910, 1069, 1274, 1294
Alw21I GWGCWC 1 cut(s) 9
Alw26I GTCTC 1 cut(s) 957
AlwI GGATC 1 cut(s) 781
AoxI GGCC 3 cut(s) 233, 740, 924
ApeKI GCWGC 7 cut(s) 308, 359, 398, 798, 907, 1244, 1274
ApoI RAATTY 1 cut(s) 836
Asp700I GAANNNNTTC 1 cut(s) 434
AspLEI GCGC 1 cut(s) 108
AspS9I GGNCC 4 cut(s) 234, 740, 1182, 1305
AsuC2I CCSGG 1 cut(s) 410
AsuHPI GGTGA 4 cut(s) 19, 76, 884, 1089
AvaII GGWCC 2 cut(s) 1182, 1305
BanI GGYRCC 2 cut(s) 379, 1388
BarI GAAGNNNNNNTAC 2 cut(s) 705, 737
Bbv12I GWGCWC 1 cut(s) 9
BbvI GCAGC 7 cut(s) 295, 346, 385, 785, 919, 1231, 1261
BccI CCATC 4 cut(s) 38, 695, 813, 953
BcgI CGANNNNNNTGC 4 cut(s) 248, 282, 300, 334
BciT130I CCWGG 4 cut(s) 351, 384, 870, 1076
BcnI CCSGG 1 cut(s) 410
BcoDI GTCTC 1 cut(s) 957
BfmI CTRYAG 2 cut(s) 309, 786
BfuAI ACCTGC 2 cut(s) 199, 1237
BlpI GCTNAGC 1 cut(s) 1266
Bme1390I CCNGG 5 cut(s) 351, 384, 410, 870, 1076
Bme18I GGWCC 2 cut(s) 1182, 1305
BmgT120I GGNCC 4 cut(s) 234, 740, 1182, 1305
BmiI GGNNCC 6 cut(s) 381, 388, 706, 741, 1306, 1390
BmrFI CCNGG 5 cut(s) 351, 384, 410, 870, 1076
BmrI ACTGGG 1 cut(s) 624
BmsI GCATC 1 cut(s) 295
BmuI ACTGGG 1 cut(s) 624
BpmI CTGGAG 2 cut(s) 372, 939
Bpu1102I GCTNAGC 1 cut(s) 1266
BpuEI CTTGAG 1 cut(s) 1155
BpuMI CCSGG 1 cut(s) 410
BsaBI GATNNNNATC 1 cut(s) 580
BsaHI GRCGYC 1 cut(s) 1161
BsaI GGTCTC 1 cut(s) 957
BsaJI CCNNGG 3 cut(s) 237, 921, 1383
BsaWI WCCGGW 1 cut(s) 182
BsaXI ACNNNNNCTCC 2 cut(s) 973, 1003
Bsc4I CCNNNNNNNGG 3 cut(s) 60, 243, 495
Bse1I ACTGG 3 cut(s) 507, 532, 619
Bse3DI GCAATG 1 cut(s) 1334
Bse8I GATNNNNATC 1 cut(s) 580
BseBI CCWGG 4 cut(s) 351, 384, 870, 1076
BseDI CCNNGG 3 cut(s) 237, 921, 1383
BseJI GATNNNNATC 1 cut(s) 580
BseLI CCNNNNNNNGG 3 cut(s) 60, 243, 495
BseMI GCAATG 1 cut(s) 1334
BseMII CTCAG 1 cut(s) 332
BseNI ACTGG 3 cut(s) 507, 532, 619
BseXI GCAGC 7 cut(s) 295, 346, 385, 785, 919, 1231, 1261
BsgI GTGCAG 1 cut(s) 1215
Bsh1236I CGCG 2 cut(s) 106, 108
BshFI GGCC 3 cut(s) 235, 742, 926
BshNI GGYRCC 2 cut(s) 379, 1388
BsiHKAI GWGCWC 1 cut(s) 9
BsiSI CCGG 2 cut(s) 183, 410
BslFI GGGAC 5 cut(s) 59, 85, 392, 902, 1318
BslI CCNNNNNNNGG 3 cut(s) 60, 243, 495
BsmAI GTCTC 1 cut(s) 957
BsmFI GGGAC 5 cut(s) 59, 85, 392, 902, 1318
BsmI GAATGC 1 cut(s) 1336
BsnI GGCC 3 cut(s) 235, 742, 926
Bso31I GGTCTC 1 cut(s) 957
Bsp1286I GDGCHC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 199, 773
Bsp1720I GCTNAGC 1 cut(s) 1266
BspACI CCGC 6 cut(s) 87, 90, 93, 104, 108, 146
BspANI GGCC 3 cut(s) 235, 742, 926
BspCNI CTCAG 1 cut(s) 333
BspFNI CGCG 2 cut(s) 106, 108
BspHI TCATGA 2 cut(s) 748, 972
BspLI GGNNCC 6 cut(s) 381, 388, 706, 741, 1306, 1390
BspMAI CTGCAG 1 cut(s) 313
BspMI ACCTGC 2 cut(s) 199, 1237
BspPI GGATC 1 cut(s) 781
BspT107I GGYRCC 2 cut(s) 379, 1388
BspTNI GGTCTC 1 cut(s) 957
BsrDI GCAATG 1 cut(s) 1334
BsrI ACTGG 3 cut(s) 507, 532, 619
BssECI CCNNGG 3 cut(s) 237, 921, 1383
BssMI GATC 2 cut(s) 199, 773
BssNI GRCGYC 1 cut(s) 1161
BssT1I CCWWGG 1 cut(s) 921
Bst2UI CCWGG 4 cut(s) 351, 384, 870, 1076
Bst4CI ACNGT 3 cut(s) 297, 636, 1037
Bst6I CTCTTC 2 cut(s) 206, 732
BstACI GRCGYC 1 cut(s) 1161
BstC8I GCNNGC 4 cut(s) 853, 1213, 1242, 1272
BstDEI CTNAG 3 cut(s) 341, 375, 1266
BstENI CCTNNNNNAGG 1 cut(s) 241
BstFNI CGCG 2 cut(s) 106, 108
BstHHI GCGC 1 cut(s) 108
BstKTI GATC 2 cut(s) 202, 776
BstMAI GTCTC 1 cut(s) 957
BstMBI GATC 2 cut(s) 199, 773
BstMWI GCNNNNNNNGC 2 cut(s) 986, 1271
BstNI CCWGG 4 cut(s) 351, 384, 870, 1076
BstNSI RCATGY 1 cut(s) 1265
BstSCI CCNGG 5 cut(s) 349, 382, 408, 868, 1074
BstSFI CTRYAG 2 cut(s) 309, 786
BstUI CGCG 2 cut(s) 106, 108
BstV1I GCAGC 7 cut(s) 295, 346, 385, 785, 919, 1231, 1261
BsuRI GGCC 3 cut(s) 235, 742, 926
BtsIMutI CAGTG 5 cut(s) 514, 525, 591, 764, 1117
BveI ACCTGC 2 cut(s) 199, 1237
Cac8I GCNNGC 4 cut(s) 853, 1213, 1242, 1272
CciI TCATGA 2 cut(s) 748, 972
CfoI GCGC 1 cut(s) 108
Cfr13I GGNCC 4 cut(s) 234, 740, 1182, 1305
CseI GACGC 2 cut(s) 972, 1169
CsiI ACCWGGT 1 cut(s) 868
Csp6I GTAC 2 cut(s) 722, 805
CviAII CATG 6 cut(s) 392, 490, 710, 749, 973, 1262
CviQI GTAC 2 cut(s) 722, 805
DdeI CTNAG 3 cut(s) 341, 375, 1266
DpnI GATC 2 cut(s) 201, 775
DpnII GATC 2 cut(s) 199, 773
Eam1104I CTCTTC 2 cut(s) 206, 732
EarI CTCTTC 2 cut(s) 206, 732
Eco130I CCWWGG 1 cut(s) 921
Eco31I GGTCTC 1 cut(s) 957
Eco47I GGWCC 2 cut(s) 1182, 1305
Eco57I CTGAAG 1 cut(s) 104
EcoNI CCTNNNNNAGG 1 cut(s) 241
EcoO109I RGGNCCY 1 cut(s) 740
EcoRII CCWGG 4 cut(s) 349, 382, 868, 1074
EcoT14I CCWWGG 1 cut(s) 921
EcoT22I ATGCAT 1 cut(s) 1336
ErhI CCWWGG 1 cut(s) 921
FaeI CATG 6 cut(s) 395, 493, 713, 752, 976, 1265
FaqI GGGAC 5 cut(s) 59, 85, 392, 902, 1318
FatI CATG 6 cut(s) 391, 489, 709, 748, 972, 1261
FauI CCCGC 1 cut(s) 111
FblI GTMKAC 1 cut(s) 177
GlaI GCGC 1 cut(s) 107
GsuI CTGGAG 2 cut(s) 372, 939
HaeIII GGCC 3 cut(s) 235, 742, 926
HapII CCGG 2 cut(s) 183, 410
HgaI GACGC 2 cut(s) 972, 1169
HhaI GCGC 1 cut(s) 108
Hin1I GRCGYC 1 cut(s) 1161
Hin1II CATG 6 cut(s) 395, 493, 713, 752, 976, 1265
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HincII GTYRAC 3 cut(s) 178, 548, 1006
HindII GTYRAC 3 cut(s) 178, 548, 1006
HinfI GANTC 9 cut(s) 17, 334, 413, 499, 544, 674, 823, 1094, 1142
HpaII CCGG 2 cut(s) 183, 410
HphI GGTGA 4 cut(s) 19, 76, 884, 1089
Hpy166II GTNNAC 4 cut(s) 178, 275, 548, 1006
Hpy188I TCNGA 7 cut(s) 123, 256, 640, 778, 818, 1123, 1315
Hpy8I GTNNAC 4 cut(s) 178, 275, 548, 1006
Hpy99I CGWCG 3 cut(s) 179, 260, 286
HpyAV CCTTC 4 cut(s) 412, 555, 707, 1369
HpyCH4III ACNGT 3 cut(s) 297, 636, 1037
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 9 cut(s) 311, 362, 401, 493, 589, 1205, 1232, 1247, 1334
HpyF10VI GCNNNNNNNGC 2 cut(s) 986, 1271
HpyF3I CTNAG 3 cut(s) 341, 375, 1266
HpySE526I ACGT 1 cut(s) 174
Hsp92I GRCGYC 1 cut(s) 1161
Hsp92II CATG 6 cut(s) 395, 493, 713, 752, 976, 1265
HspAI GCGC 1 cut(s) 106
Kzo9I GATC 2 cut(s) 199, 773
LmnI GCTCC 3 cut(s) 257, 392, 994
Lsp1109I GCAGC 7 cut(s) 295, 346, 385, 785, 919, 1231, 1261
LweI GCATC 1 cut(s) 295
MabI ACCWGGT 1 cut(s) 868
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 7 cut(s) 160, 328, 461, 662, 860, 937, 1112
MalI GATC 2 cut(s) 201, 775
MboI GATC 2 cut(s) 199, 773
MboII GAAGA 9 cut(s) 110, 223, 427, 719, 1039, 1066, 1182, 1360, 1384
MfeI CAATTG 1 cut(s) 363
MhlI GDGCHC 1 cut(s) 9
MluCI AATT 6 cut(s) 203, 229, 363, 595, 836, 929
MlyI GAGTC 1 cut(s) 553
MmeI TCCRAC 1 cut(s) 279
Mph1103I ATGCAT 1 cut(s) 1336
MroXI GAANNNNTTC 1 cut(s) 434
MseI TTAA 1 cut(s) 1017
MspI CCGG 2 cut(s) 183, 410
MspR9I CCNGG 5 cut(s) 351, 384, 410, 870, 1076
MunI CAATTG 1 cut(s) 363
Mva1269I GAATGC 1 cut(s) 1336
MvaI CCWGG 4 cut(s) 351, 384, 870, 1076
MvnI CGCG 2 cut(s) 106, 108
MwoI GCNNNNNNNGC 2 cut(s) 986, 1271
NciI CCSGG 1 cut(s) 410
NdeII GATC 2 cut(s) 199, 773
NlaIII CATG 6 cut(s) 395, 493, 713, 752, 976, 1265
NlaIV GGNNCC 6 cut(s) 381, 388, 706, 741, 1306, 1390
NmeAIII GCCGAG 1 cut(s) 79
NmuCI GTSAC 4 cut(s) 160, 461, 937, 1112
NsiI ATGCAT 1 cut(s) 1336
NspI RCATGY 1 cut(s) 1265
PagI TCATGA 2 cut(s) 748, 972
PaqCI CACCTGC 1 cut(s) 1237
PctI GAATGC 1 cut(s) 1336
PdmI GAANNNNTTC 1 cut(s) 434
PfeI GAWTC 8 cut(s) 17, 334, 413, 499, 674, 823, 1094, 1142
PfoI TCCNGGA 2 cut(s) 349, 408
PleI GAGTC 1 cut(s) 552
PpsI GAGTC 1 cut(s) 552
Psp6I CCWGG 4 cut(s) 349, 382, 868, 1074
PspGI CCWGG 4 cut(s) 349, 382, 868, 1074
PspN4I GGNNCC 6 cut(s) 381, 388, 706, 741, 1306, 1390
PspPI GGNCC 4 cut(s) 234, 740, 1182, 1305
PstI CTGCAG 1 cut(s) 313
RsaI GTAC 2 cut(s) 723, 806
RsaNI GTAC 2 cut(s) 722, 805
SalI GTCGAC 1 cut(s) 176
SaqAI TTAA 1 cut(s) 1017
Sau3AI GATC 2 cut(s) 199, 773
Sau96I GGNCC 4 cut(s) 234, 740, 1182, 1305
SchI GAGTC 1 cut(s) 553
ScrFI CCNGG 5 cut(s) 351, 384, 410, 870, 1076
SduI GDGCHC 1 cut(s) 9
SexAI ACCWGGT 1 cut(s) 868
SfaNI GCATC 1 cut(s) 295
SfcI CTRYAG 2 cut(s) 309, 786
SinI GGWCC 2 cut(s) 1182, 1305
SmlI CTYRAG 1 cut(s) 1170
SmoI CTYRAG 1 cut(s) 1170
Sse9I AATT 6 cut(s) 203, 229, 363, 595, 836, 929
SsiI CCGC 6 cut(s) 87, 90, 93, 104, 108, 146
SspI AATATT 1 cut(s) 481
StyD4I CCNGG 5 cut(s) 349, 382, 408, 868, 1074
StyI CCWWGG 1 cut(s) 921
TaaI ACNGT 3 cut(s) 297, 636, 1037
TaiI ACGT 1 cut(s) 177
TaqI TCGA 5 cut(s) 177, 320, 416, 559, 574
TasI AATT 6 cut(s) 203, 229, 363, 595, 836, 929
TauI GCSGC 4 cut(s) 92, 95, 111, 148
TfiI GAWTC 8 cut(s) 17, 334, 413, 499, 674, 823, 1094, 1142
Tru1I TTAA 1 cut(s) 1017
Tru9I TTAA 1 cut(s) 1017
TscAI CASTG 5 cut(s) 514, 532, 591, 764, 1117
TseFI GTSAC 4 cut(s) 160, 461, 937, 1112
TseI GCWGC 7 cut(s) 308, 359, 398, 798, 907, 1244, 1274
Tsp45I GTSAC 4 cut(s) 160, 461, 937, 1112
TspDTI ATGAA 5 cut(s) 570, 726, 737, 961, 1029
TspGWI ACGGA 1 cut(s) 10
TspRI CASTG 5 cut(s) 514, 532, 591, 764, 1117
VpaK11BI GGWCC 2 cut(s) 1182, 1305
XagI CCTNNNNNAGG 1 cut(s) 241
XapI RAATTY 1 cut(s) 836
XceI RCATGY 1 cut(s) 1265
XcmI CCANNNNNNNNNTGG 1 cut(s) 665
XmiI GTMKAC 1 cut(s) 177
XmnI GAANNNNTTC 1 cut(s) 434
Zsp2I ATGCAT 1 cut(s) 1336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.