Rorug02G0246500

Functions in the early steps of protein synthesis of a small number of specific mRNAs. Acts by directing the binding of methionyl-tRNAi to 40S ribosomal subunits. In contrast to the eIF- 2 complex, it binds methionyl-tRNAi to 40 S subunits in a codon- dependent manner, whereas the eIF-2 complex binds methionyl-tRNAi to 40 S subunits in a GTP-dependent manner. May act by impiging the expression of specific proteins

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
25632121 .. 25633916
1796 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0246500.1

Sequence Viewer

Length: 519 bp
ATGTTGTTAGGGAAGCGTCCTCGCCCTCCGATTCGGAGAACGACAAGCATGACCGGGATCACCGTCGATCTGAACAACGTGGAAGACCAGGAGCCGACTGAAAACCCTAGCATGATGGATGTGCATGCATCATCGACGGTGGTGGGCCTTGATGGGCCTGTTAATTATAATCAGAGCCCTAACAGCTTGGGGTATCATGAACAGCACCGTTTCTTGGCCATGTTGTCACCCAGAACCAACAGCAGCAACCACAGAAGAAACTCGGCCTCCGACCTAGTCGAAACCGCTCACTTCCTCCGCACCTGCGGCCTCTGCAAACGGAGCTTGGCTTCCGGCCGCGACCTCTATATGTATAGGGGAGACACAGCTTTTTGCAGCCTGGAATGCAGAGAGCAGCAGATGAAGCAAGACGAGAGAGTAGAGAAGTGTAAGGGGGTGGCCTCGAAGAAAGAGGACCGCCATGCAACTCGATCGAGTTCCAAGGCCTCTGGTAAAACCCAGACTGTGGCCGCTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

19.13

Weight (kDa)

9.22

Isoelectric Point (pI)

53.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-FLZ PF04570 90 - 139 5.2e-25 zinc-finger of the FCS-type, C2-C2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010315)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AarI CACCTGC 1 cut(s) 311
Acc36I ACCTGC 1 cut(s) 311
AccB7I CCANNNNNTGG 1 cut(s) 505
AccBSI CCGCTC 1 cut(s) 287
AccII CGCG 1 cut(s) 339
AciI CCGC 6 cut(s) 285, 298, 306, 337, 457, 510
AclWI GGATC 1 cut(s) 65
AcoI YGGCCR 3 cut(s) 216, 334, 507
AfiI CCNNNNNNNGG 2 cut(s) 214, 505
AjnI CCWGG 2 cut(s) 87, 378
AluBI AGCT 3 cut(s) 186, 324, 368
AluI AGCT 3 cut(s) 186, 324, 368
Alw26I GTCTC 1 cut(s) 354
AlwI GGATC 1 cut(s) 65
AoxI GGCC 9 cut(s) 145, 155, 216, 264, 307, 334, 438, 483, 507
ApeKI GCWGC 4 cut(s) 243, 375, 394, 512
AspS9I GGNCC 3 cut(s) 145, 155, 454
AsuC2I CCSGG 1 cut(s) 55
AsuHPI GGTGA 2 cut(s) 52, 219
AvaII GGWCC 1 cut(s) 454
BalI TGGCCA 1 cut(s) 218
BanII GRGCYC 1 cut(s) 179
BbsI GAAGAC 1 cut(s) 90
BbvI GCAGC 4 cut(s) 255, 387, 406, 499
BccI CCATC 2 cut(s) 109, 146
BcgI CGANNNNNNTGC 2 cut(s) 453, 487
BciT130I CCWGG 2 cut(s) 89, 380
BcnI CCSGG 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 354
BfaI CTAG 2 cut(s) 108, 275
BfuAI ACCTGC 1 cut(s) 311
BisI GCNGC 7 cut(s) 244, 307, 337, 376, 395, 510, 513
BlsI GCNGC 7 cut(s) 245, 308, 338, 377, 396, 511, 514
Bme1390I CCNGG 3 cut(s) 55, 89, 380
Bme18I GGWCC 1 cut(s) 454
BmgT120I GGNCC 3 cut(s) 145, 155, 454
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 3 cut(s) 55, 89, 380
BmsI GCATC 1 cut(s) 137
BpiI GAAGAC 1 cut(s) 90
BpuMI CCSGG 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 480
BsaXI ACNNNNNCTCC 2 cut(s) 251, 281
Bsc4I CCNNNNNNNGG 2 cut(s) 214, 505
BseBI CCWGG 2 cut(s) 89, 380
BseDI CCNNGG 1 cut(s) 480
BseGI GGATG 1 cut(s) 124
BseLI CCNNNNNNNGG 2 cut(s) 214, 505
BseX3I CGGCCG 1 cut(s) 334
BseXI GCAGC 4 cut(s) 255, 387, 406, 499
Bsh1236I CGCG 1 cut(s) 339
Bsh1285I CGRYCG 2 cut(s) 337, 473
BshFI GGCC 9 cut(s) 147, 157, 218, 266, 309, 336, 440, 485, 509
BsiEI CGRYCG 2 cut(s) 337, 473
BsiSI CCGG 2 cut(s) 54, 333
BslI CCNNNNNNNGG 2 cut(s) 214, 505
BsmAI GTCTC 1 cut(s) 354
BsmI GAATGC 1 cut(s) 389
BsnI GGCC 9 cut(s) 147, 157, 218, 266, 309, 336, 440, 485, 509
Bsp1286I GDGCHC 1 cut(s) 179
Bsp143I GATC 3 cut(s) 57, 67, 470
BspACI CCGC 6 cut(s) 285, 298, 306, 337, 457, 510
BspANI GGCC 9 cut(s) 147, 157, 218, 266, 309, 336, 440, 485, 509
BspFNI CGCG 1 cut(s) 339
BspHI TCATGA 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 93
BspMI ACCTGC 1 cut(s) 311
BspPI GGATC 1 cut(s) 65
BsrBI CCGCTC 1 cut(s) 287
BssECI CCNNGG 1 cut(s) 480
BssMI GATC 3 cut(s) 57, 67, 470
BssT1I CCWWGG 1 cut(s) 480
Bst2UI CCWGG 2 cut(s) 89, 380
Bst4CI ACNGT 4 cut(s) 64, 139, 209, 505
BstC8I GCNNGC 1 cut(s) 126
BstF5I GGATG 1 cut(s) 124
BstFNI CGCG 1 cut(s) 339
BstKTI GATC 3 cut(s) 60, 70, 473
BstMAI GTCTC 1 cut(s) 354
BstMBI GATC 3 cut(s) 57, 67, 470
BstMCI CGRYCG 2 cut(s) 337, 473
BstMWI GCNNNNNNNGC 6 cut(s) 183, 306, 312, 321, 384, 403
BstNI CCWGG 2 cut(s) 89, 380
BstNSI RCATGY 1 cut(s) 128
BstSCI CCNGG 3 cut(s) 53, 87, 378
BstUI CGCG 1 cut(s) 339
BstV1I GCAGC 4 cut(s) 255, 387, 406, 499
BstV2I GAAGAC 1 cut(s) 90
BstZI CGGCCG 1 cut(s) 334
BsuRI GGCC 9 cut(s) 147, 157, 218, 266, 309, 336, 440, 485, 509
BtsCI GGATG 1 cut(s) 124
BveI ACCTGC 1 cut(s) 311
Cac8I GCNNGC 1 cut(s) 126
CciI TCATGA 1 cut(s) 196
Cfr13I GGNCC 3 cut(s) 145, 155, 454
CseI GACGC 1 cut(s) 5
CviAII CATG 6 cut(s) 49, 112, 125, 197, 220, 461
DpnI GATC 3 cut(s) 59, 69, 472
DpnII GATC 3 cut(s) 57, 67, 470
EaeI YGGCCR 3 cut(s) 216, 334, 507
EagI CGGCCG 1 cut(s) 334
EclXI CGGCCG 1 cut(s) 334
Eco130I CCWWGG 1 cut(s) 480
Eco147I AGGCCT 1 cut(s) 485
Eco24I GRGCYC 1 cut(s) 179
Eco47I GGWCC 1 cut(s) 454
Eco52I CGGCCG 1 cut(s) 334
EcoRII CCWGG 2 cut(s) 87, 378
EcoT14I CCWWGG 1 cut(s) 480
EcoT22I ATGCAT 1 cut(s) 130
EcoT38I GRGCYC 1 cut(s) 179
ErhI CCWWGG 1 cut(s) 480
FaeI CATG 6 cut(s) 52, 115, 128, 200, 223, 464
FatI CATG 6 cut(s) 48, 111, 124, 196, 219, 460
Fnu4HI GCNGC 7 cut(s) 244, 307, 337, 376, 395, 510, 513
FokI GGATG 1 cut(s) 131
FriOI GRGCYC 1 cut(s) 179
Fsp4HI GCNGC 7 cut(s) 244, 307, 337, 376, 395, 510, 513
FspBI CTAG 2 cut(s) 108, 275
GluI GCNGC 7 cut(s) 244, 307, 337, 376, 395, 510, 513
HaeIII GGCC 9 cut(s) 147, 157, 218, 266, 309, 336, 440, 485, 509
HapII CCGG 2 cut(s) 54, 333
HgaI GACGC 1 cut(s) 5
Hin1II CATG 6 cut(s) 52, 115, 128, 200, 223, 464
HinfI GANTC 1 cut(s) 31
HpaII CCGG 2 cut(s) 54, 333
HphI GGTGA 2 cut(s) 52, 219
Hpy188I TCNGA 5 cut(s) 30, 36, 72, 174, 271
Hpy188III TCNNGA 1 cut(s) 197
Hpy99I CGWCG 2 cut(s) 68, 139
HpyCH4III ACNGT 4 cut(s) 64, 139, 209, 505
HpyCH4IV ACGT 1 cut(s) 78
HpyCH4V TGCA 6 cut(s) 124, 128, 315, 375, 387, 464
HpyF10VI GCNNNNNNNGC 6 cut(s) 183, 306, 312, 321, 384, 403
HpySE526I ACGT 1 cut(s) 78
Hsp92II CATG 6 cut(s) 52, 115, 128, 200, 223, 464
Kzo9I GATC 3 cut(s) 57, 67, 470
LmnI GCTCC 2 cut(s) 91, 321
Lsp1109I GCAGC 4 cut(s) 255, 387, 406, 499
LweI GCATC 1 cut(s) 137
MaeI CTAG 2 cut(s) 108, 275
MaeII ACGT 1 cut(s) 78
MaeIII GTNAC 1 cut(s) 225
MalI GATC 3 cut(s) 59, 69, 472
MbiI CCGCTC 1 cut(s) 287
MboI GATC 3 cut(s) 57, 67, 470
MboII GAAGA 3 cut(s) 95, 267, 457
MhlI GDGCHC 1 cut(s) 179
MlsI TGGCCA 1 cut(s) 218
MluCI AATT 1 cut(s) 163
MluNI TGGCCA 1 cut(s) 218
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 9 cut(s) 30, 36, 277, 305, 320, 353, 445, 451, 496
Mox20I TGGCCA 1 cut(s) 218
Mph1103I ATGCAT 1 cut(s) 130
MscI TGGCCA 1 cut(s) 218
MseI TTAA 2 cut(s) 162, 517
Msp20I TGGCCA 1 cut(s) 218
MspA1I CMGCKG 1 cut(s) 512
MspI CCGG 2 cut(s) 54, 333
MspR9I CCNGG 3 cut(s) 55, 89, 380
Mva1269I GAATGC 1 cut(s) 389
MvaI CCWGG 2 cut(s) 89, 380
MvnI CGCG 1 cut(s) 339
MwoI GCNNNNNNNGC 6 cut(s) 183, 306, 312, 321, 384, 403
NciI CCSGG 1 cut(s) 55
NdeII GATC 3 cut(s) 57, 67, 470
NlaIII CATG 6 cut(s) 52, 115, 128, 200, 223, 464
NlaIV GGNNCC 1 cut(s) 93
NmeAIII GCCGAG 1 cut(s) 242
NmuCI GTSAC 1 cut(s) 225
NsiI ATGCAT 1 cut(s) 130
NspI RCATGY 1 cut(s) 128
PaeI GCATGC 1 cut(s) 128
PagI TCATGA 1 cut(s) 196
PaqCI CACCTGC 1 cut(s) 311
PceI AGGCCT 1 cut(s) 485
PctI GAATGC 1 cut(s) 389
PfeI GAWTC 1 cut(s) 31
PflFI GACNNNGTC 1 cut(s) 275
PflMI CCANNNNNTGG 1 cut(s) 505
PkrI GCNGC 7 cut(s) 245, 308, 338, 377, 396, 511, 514
Ple19I CGATCG 1 cut(s) 473
PsiI TTATAA 1 cut(s) 168
Psp6I CCWGG 2 cut(s) 87, 378
PspGI CCWGG 2 cut(s) 87, 378
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 3 cut(s) 145, 155, 454
PsyI GACNNNGTC 1 cut(s) 275
PvuI CGATCG 1 cut(s) 473
SaqAI TTAA 2 cut(s) 162, 517
SatI GCNGC 7 cut(s) 244, 307, 337, 376, 395, 510, 513
Sau3AI GATC 3 cut(s) 57, 67, 470
Sau96I GGNCC 3 cut(s) 145, 155, 454
ScrFI CCNGG 3 cut(s) 55, 89, 380
SduI GDGCHC 1 cut(s) 179
SetI ASST 7 cut(s) 81, 188, 276, 305, 326, 345, 370
SfaNI GCATC 1 cut(s) 137
SinI GGWCC 1 cut(s) 454
SphI GCATGC 1 cut(s) 128
Sse9I AATT 1 cut(s) 163
SseBI AGGCCT 1 cut(s) 485
SsiI CCGC 6 cut(s) 285, 298, 306, 337, 457, 510
SspMI CTAG 2 cut(s) 108, 275
StuI AGGCCT 1 cut(s) 485
StyD4I CCNGG 3 cut(s) 53, 87, 378
StyI CCWWGG 1 cut(s) 480
TaaI ACNGT 4 cut(s) 64, 139, 209, 505
TaiI ACGT 1 cut(s) 81
TaqI TCGA 6 cut(s) 66, 134, 279, 443, 469, 473
TasI AATT 1 cut(s) 163
TauI GCSGC 3 cut(s) 309, 339, 512
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 2 cut(s) 162, 517
Tru9I TTAA 2 cut(s) 162, 517
TseFI GTSAC 1 cut(s) 225
TseI GCWGC 4 cut(s) 243, 375, 394, 512
Tsp45I GTSAC 1 cut(s) 225
TspDTI ATGAA 2 cut(s) 213, 416
TspGWI ACGGA 1 cut(s) 334
Tth111I GACNNNGTC 1 cut(s) 275
Van91I CCANNNNNTGG 1 cut(s) 505
VpaK11BI GGWCC 1 cut(s) 454
XceI RCATGY 1 cut(s) 128
XspI CTAG 2 cut(s) 108, 275
Zsp2I ATGCAT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.