Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000187.1

Orthogroup ID

OG0008492

Physical Location & Seq

Genomic Coordinates Forward (+)

88684 .. 89971

Gene Structure 1288 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000187.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 543 bp

atgtgtggtggtgagccaagggcaatgcttagaaaaaatcgaggcaaagctgattccccaatatattccatccaaatttgcattccgaagcatgctctgaacttaattttttcatttacaaatggagatgaatgggatggtccttacagattacaatttcaagtccccaagggtttcaaaaacaaaccaattgaattcttcaacgagggactagctgaagagctgagtaaagatggtgcttgcgaaagagcaatctttcctgattcgagcattgttgtgaatagatgtaccatcatgggaaatttgacggttgaaggaggactagctgaagagctgagtaaagatggtgcttgcgaaagagcaatctttcctgattcgagcattgttgtgaatagatgtaccatcatgggaaatttgacggttgaaggaggtgatcgttgcaaccttgatctcagactgggatgcacagatcccagctcacctctttatgacccgaatgccaatgtagacgatggaacatgcccaatggatctggattcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

180

Amino Acids

19.66

Weight (kDa)

4.62

Isoelectric Point (pI)

39.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008492)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G15840 AT3G15840 AT3G15840 AT3G15840 AT3G15840
fragaria_vesca	FvH4_6g29710
malus_domestica	MD17G1212100.v1.1
prunus_persica	Prupe.3G087300_v2.0.a1 Prupe.3G087300_v2.0.a1 Prupe.3G087300_v2.0.a1 Prupe.3G087300_v2.0.a1 Prupe.3G087300_v2.0.a1
pyrus_communis	pycom17g21700
rosa_chinensis	RchiOBHm_Chr2g0135411
rosa_laevigata	RLG00000019461
rosa_multiflora	Rmu_ssc0000187.1_g000018
rosa_roxburghii	Rroxscaffold_2G00109270
rosa_rugosa	Rorug02G0324700
rosa_samantha	Rh2AG370300 Rh2BG381800 Rh2CG360400 Rh2DG398100
rosa_wichuraiana	Rw2G030660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	507
AclWI	GGATC	2 cut(s)	464, 537
AcsI	RAATTY	4 cut(s)	75, 194, 301, 412
AcuI	CTGAAG	2 cut(s)	237, 348
AfaI	GTAC	2 cut(s)	289, 400
AgsI	TTSAA	6 cut(s)	161, 178, 194, 202, 314, 425
AjuI	GAANNNNNNNTTGG	2 cut(s)	66, 98
AluBI	AGCT	6 cut(s)	50, 215, 223, 326, 334, 477
AluI	AGCT	6 cut(s)	50, 215, 223, 326, 334, 477
AlwI	GGATC	2 cut(s)	464, 537
ApoI	RAATTY	4 cut(s)	75, 194, 301, 412
AspS9I	GGNCC	1 cut(s)	140
AsuHPI	GGTGA	3 cut(s)	23, 443, 471
AvaII	GGWCC	1 cut(s)	140
BccI	CCATC	7 cut(s)	77, 131, 227, 299, 338, 410, 506
BfaI	CTAG	2 cut(s)	212, 323
Bme18I	GGWCC	1 cut(s)	140
BmgT120I	GGNCC	1 cut(s)	140
BmrI	ACTGGG	1 cut(s)	467
BmsI	GCATC	1 cut(s)	452
BmuI	ACTGGG	1 cut(s)	467
BsaJI	CCNNGG	2 cut(s)	17, 168
Bse1I	ACTGG	1 cut(s)	462
Bse3DI	GCAATG	1 cut(s)	30
BseDI	CCNNGG	2 cut(s)	17, 168
BseGI	GGATG	3 cut(s)	69, 142, 467
BseMI	GCAATG	1 cut(s)	30
BseMII	CTCAG	3 cut(s)	215, 326, 466
BseNI	ACTGG	1 cut(s)	462
BseYI	CCCAGC	1 cut(s)	473
BslFI	GGGAC	2 cut(s)	149, 222
BsmFI	GGGAC	2 cut(s)	149, 222
BsmI	GAATGC	2 cut(s)	81, 502
Bsp143I	GATC	4 cut(s)	433, 448, 469, 529
BspCNI	CTCAG	3 cut(s)	216, 327, 465
BspPI	GGATC	2 cut(s)	464, 537
BspQI	GCTCTTC	2 cut(s)	213, 324
BsrDI	GCAATG	1 cut(s)	30
BsrI	ACTGG	1 cut(s)	462
BssECI	CCNNGG	2 cut(s)	17, 168
BssMI	GATC	4 cut(s)	433, 448, 469, 529
BssT1I	CCWWGG	2 cut(s)	17, 168
Bst4CI	ACNGT	2 cut(s)	310, 421
Bst6I	CTCTTC	2 cut(s)	213, 324
BstC8I	GCNNGC	3 cut(s)	93, 241, 352
BstDEI	CTNAG	5 cut(s)	29, 224, 335, 452, 540
BstF5I	GGATG	3 cut(s)	69, 142, 467
BstKTI	GATC	4 cut(s)	436, 451, 472, 532
BstMBI	GATC	4 cut(s)	433, 448, 469, 529
BstNSI	RCATGY	2 cut(s)	95, 522
BstX2I	RGATCY	2 cut(s)	469, 529
BstYI	RGATCY	2 cut(s)	469, 529
BtsCI	GGATG	3 cut(s)	69, 142, 467
Cac8I	GCNNGC	3 cut(s)	93, 241, 352
Cfr13I	GGNCC	1 cut(s)	140
Csp6I	GTAC	2 cut(s)	288, 399
CviAII	CATG	4 cut(s)	92, 295, 406, 519
CviJI	RGCY	7 cut(s)	16, 50, 215, 223, 326, 334, 477
CviKI_1	RGCY	7 cut(s)	16, 50, 215, 223, 326, 334, 477
CviQI	GTAC	2 cut(s)	288, 399
DdeI	CTNAG	5 cut(s)	29, 224, 335, 452, 540
DpnI	GATC	4 cut(s)	435, 450, 471, 531
DpnII	GATC	4 cut(s)	433, 448, 469, 529
Eam1104I	CTCTTC	2 cut(s)	213, 324
EarI	CTCTTC	2 cut(s)	213, 324
Eco130I	CCWWGG	2 cut(s)	17, 168
Eco47I	GGWCC	1 cut(s)	140
Eco57I	CTGAAG	2 cut(s)	237, 348
EcoRI	GAATTC	1 cut(s)	194
EcoT14I	CCWWGG	2 cut(s)	17, 168
ErhI	CCWWGG	2 cut(s)	17, 168
FaeI	CATG	4 cut(s)	95, 298, 409, 522
FaiI	YATR	6 cut(s)	64, 93, 296, 407, 489, 520
FaqI	GGGAC	2 cut(s)	149, 222
FatI	CATG	4 cut(s)	91, 294, 405, 518
FblI	GTMKAC	1 cut(s)	507
FokI	GGATG	3 cut(s)	56, 149, 474
FspBI	CTAG	2 cut(s)	212, 323
GsaI	CCCAGC	1 cut(s)	477
Hin1II	CATG	4 cut(s)	95, 298, 409, 522
HinfI	GANTC	4 cut(s)	53, 263, 374, 536
HphI	GGTGA	3 cut(s)	23, 443, 471
Hpy166II	GTNNAC	1 cut(s)	508
Hpy188I	TCNGA	3 cut(s)	87, 99, 455
Hpy188III	TCNNGA	3 cut(s)	260, 371, 533
Hpy8I	GTNNAC	1 cut(s)	508
HpyAV	CCTTC	2 cut(s)	308, 419
HpyCH4III	ACNGT	2 cut(s)	310, 421
HpyCH4V	TGCA	3 cut(s)	81, 441, 465
HpyF3I	CTNAG	5 cut(s)	29, 224, 335, 452, 540
Hsp92II	CATG	4 cut(s)	95, 298, 409, 522
Kzo9I	GATC	4 cut(s)	433, 448, 469, 529
LguI	GCTCTTC	2 cut(s)	213, 324
LpnPI	CCDG	5 cut(s)	273, 384, 443, 487, 518
LweI	GCATC	1 cut(s)	452
MaeI	CTAG	2 cut(s)	212, 323
MalI	GATC	4 cut(s)	435, 450, 471, 531
MboI	GATC	4 cut(s)	433, 448, 469, 529
MboII	GAAGA	3 cut(s)	190, 230, 341
MfeI	CAATTG	1 cut(s)	189
MflI	RGATCY	2 cut(s)	469, 529
MluCI	AATT	7 cut(s)	75, 105, 155, 189, 194, 301, 412
MnlI	CCTC	5 cut(s)	35, 199, 311, 422, 492
MseI	TTAA	1 cut(s)	104
MslI	CAYNNNNRTG	2 cut(s)	275, 386
MunI	CAATTG	1 cut(s)	189
Mva1269I	GAATGC	2 cut(s)	81, 502
NdeII	GATC	4 cut(s)	433, 448, 469, 529
NlaIII	CATG	4 cut(s)	95, 298, 409, 522
NspI	RCATGY	2 cut(s)	95, 522
PaeI	GCATGC	1 cut(s)	95
PciSI	GCTCTTC	2 cut(s)	213, 324
PctI	GAATGC	2 cut(s)	81, 502
PfeI	GAWTC	4 cut(s)	53, 263, 374, 536
PspFI	CCCAGC	1 cut(s)	473
PspPI	GGNCC	1 cut(s)	140
PsuI	RGATCY	2 cut(s)	469, 529
RsaI	GTAC	2 cut(s)	289, 400
RsaNI	GTAC	2 cut(s)	288, 399
RseI	CAYNNNNRTG	2 cut(s)	275, 386
SapI	GCTCTTC	2 cut(s)	213, 324
SaqAI	TTAA	1 cut(s)	104
Sau3AI	GATC	4 cut(s)	433, 448, 469, 529
Sau96I	GGNCC	1 cut(s)	140
SetI	ASST	9 cut(s)	52, 217, 225, 328, 336, 433, 447, 479, 484
SfaNI	GCATC	1 cut(s)	452
SinI	GGWCC	1 cut(s)	140
SmiMI	CAYNNNNRTG	2 cut(s)	275, 386
SphI	GCATGC	1 cut(s)	95
Sse9I	AATT	7 cut(s)	75, 105, 155, 189, 194, 301, 412
SspMI	CTAG	2 cut(s)	212, 323
StyI	CCWWGG	2 cut(s)	17, 168
TaaI	ACNGT	2 cut(s)	310, 421
TaqI	TCGA	3 cut(s)	40, 266, 377
TasI	AATT	7 cut(s)	75, 105, 155, 189, 194, 301, 412
TfiI	GAWTC	4 cut(s)	53, 263, 374, 536
Tru1I	TTAA	1 cut(s)	104
Tru9I	TTAA	1 cut(s)	104
TspDTI	ATGAA	2 cut(s)	102, 144
VpaK11BI	GGWCC	1 cut(s)	140
XapI	RAATTY	4 cut(s)	75, 194, 301, 412
XceI	RCATGY	2 cut(s)	95, 522
XmiI	GTMKAC	1 cut(s)	507
XspI	CTAG	2 cut(s)	212, 323

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.