Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000311.1

Orthogroup ID

OG0003317

Physical Location & Seq

Genomic Coordinates Forward (+)

31015 .. 31341

Gene Structure 327 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000311.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 327 bp

atggagttagaggaatatagtggagctggttctgtaaaatcttcagatataagtgatgatggtggtggcggaagaagagatggtgaaggtgacaataatggcttgatgtatttggtgtgggaagatgtgagtgttctgcttccaaactttggtattggaaatagcactaatggaggacacaccagaagattgcttgatggcctcactggttttgctgagcctggtaggatcctggctattatgggtccttctggctctggaaaatcaacccttcttgatgccctcgcaggcctctctctctctctctctctctctctctctgtataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003002 GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0006810 GO:0006950 GO:0006970 GO:0007275 GO:0007389 GO:0008150 GO:0009506 GO:0009628 GO:0009651 GO:0015399 GO:0015405 GO:0016020 GO:0016021 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0030054 GO:0031224 GO:0032501 GO:0032502 GO:0042623 GO:0042626 GO:0043492 GO:0044425 GO:0044464 GO:0048856 GO:0050896 GO:0051179 GO:0051234 GO:0055044 GO:0055085 GO:0071702 GO:0071944 GO:0080051 GO:0080167 GO:0080172

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran

Protein Analysis

108

Amino Acids

11.03

Weight (kDa)

4.37

Isoelectric Point (pI)

29.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003317)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G51460
fragaria_vesca	FvH4_3g28480 FvH4_3g28480 FvH4_3g28480 FvH4_3g28480 FvH4_3g28480 FvH4_3g28480 FvH4_3g28480 FvH4_3g28480 FvH4_3g28480 FvH4_3g28480
malus_domestica	MD00G1192100.v1.1 MD03G1172300.v1.1
prunus_persica	Prupe.4G254300_v2.0.a1 Prupe.4G254300_v2.0.a1 Prupe.4G254300_v2.0.a1 Prupe.4G254300_v2.0.a1 Prupe.4G254300_v2.0.a1 Prupe.4G254300_v2.0.a1
pyrus_communis	pycom03g12950
rosa_chinensis	RchiOBHm_Chr5g0052851 RchiOBHm_Chr5g0052971
rosa_laevigata	RLG00000034787
rosa_multiflora	Rmu_sc0006729.1_g000004 Rmu_ssc0000311.1_g000005 Rmu_ssc0000311.1_g000013
rosa_roxburghii	Rroxscaffold_1G00027600 Rroxscaffold_1G00028670 Rroxscaffold_1G00028720 Rroxscaffold_1G00028730
rosa_rugosa	Rorug05G0269000
rosa_samantha	Rh5BG352000 Rh5CG378600 Rh5DG368300
rosa_wichuraiana	Rw5G032170 Rw5G032180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	149
AciI	CCGC	1 cut(s)	69
AclWI	GGATC	2 cut(s)	223, 236
AcuI	CTGAAG	1 cut(s)	27
AfiI	CCNNNNNNNGG	1 cut(s)	149
AjnI	CCWGG	2 cut(s)	220, 231
AluBI	AGCT	1 cut(s)	26
AluI	AGCT	1 cut(s)	26
AlwI	GGATC	2 cut(s)	223, 236
AoxI	GGCC	2 cut(s)	199, 289
AspS9I	GGNCC	1 cut(s)	245
AsuHPI	GGTGA	2 cut(s)	95, 101
AvaII	GGWCC	1 cut(s)	245
BamHI	GGATCC	1 cut(s)	228
BccI	CCATC	3 cut(s)	53, 74, 191
BciT130I	CCWGG	2 cut(s)	222, 233
BlpI	GCTNAGC	1 cut(s)	216
Bme1390I	CCNGG	2 cut(s)	222, 233
Bme18I	GGWCC	1 cut(s)	245
BmgT120I	GGNCC	1 cut(s)	245
BmiI	GGNNCC	2 cut(s)	230, 246
BmrFI	CCNGG	2 cut(s)	222, 233
BmsI	GCATC	1 cut(s)	268
Bpu1102I	GCTNAGC	1 cut(s)	216
Bsc4I	CCNNNNNNNGG	1 cut(s)	149
Bse1I	ACTGG	1 cut(s)	211
BseBI	CCWGG	2 cut(s)	222, 233
BseLI	CCNNNNNNNGG	1 cut(s)	149
BseMII	CTCAG	1 cut(s)	207
BseNI	ACTGG	1 cut(s)	211
BshFI	GGCC	2 cut(s)	201, 291
BslI	CCNNNNNNNGG	1 cut(s)	149
BsnI	GGCC	2 cut(s)	201, 291
Bsp143I	GATC	1 cut(s)	228
Bsp1720I	GCTNAGC	1 cut(s)	216
BspACI	CCGC	1 cut(s)	69
BspANI	GGCC	2 cut(s)	201, 291
BspCNI	CTCAG	1 cut(s)	208
BspLI	GGNNCC	2 cut(s)	230, 246
BspPI	GGATC	2 cut(s)	223, 236
BsrI	ACTGG	1 cut(s)	211
BssMI	GATC	1 cut(s)	228
Bst2UI	CCWGG	2 cut(s)	222, 233
Bst6I	CTCTTC	1 cut(s)	70
BstC8I	GCNNGC	1 cut(s)	289
BstDEI	CTNAG	1 cut(s)	216
BstKTI	GATC	1 cut(s)	231
BstMBI	GATC	1 cut(s)	228
BstNI	CCWGG	2 cut(s)	222, 233
BstSCI	CCNGG	2 cut(s)	220, 231
BstX2I	RGATCY	1 cut(s)	228
BstYI	RGATCY	1 cut(s)	228
BsuRI	GGCC	2 cut(s)	201, 291
BtsIMutI	CAGTG	1 cut(s)	204
Cac8I	GCNNGC	1 cut(s)	289
Cfr13I	GGNCC	1 cut(s)	245
CviJI	RGCY	7 cut(s)	26, 102, 201, 220, 236, 255, 291
CviKI_1	RGCY	7 cut(s)	26, 102, 201, 220, 236, 255, 291
DdeI	CTNAG	1 cut(s)	216
DpnI	GATC	1 cut(s)	230
DpnII	GATC	1 cut(s)	228
Eam1104I	CTCTTC	1 cut(s)	70
EarI	CTCTTC	1 cut(s)	70
EciI	GGCGGA	1 cut(s)	84
Eco147I	AGGCCT	1 cut(s)	291
Eco47I	GGWCC	1 cut(s)	245
Eco57I	CTGAAG	1 cut(s)	27
EcoO109I	RGGNCCY	1 cut(s)	245
EcoRII	CCWGG	2 cut(s)	220, 231
FaiI	YATR	4 cut(s)	18, 50, 242, 325
HaeIII	GGCC	2 cut(s)	201, 291
HphI	GGTGA	2 cut(s)	95, 101
Hpy188I	TCNGA	1 cut(s)	46
Hpy188III	TCNNGA	2 cut(s)	258, 275
HpyAV	CCTTC	3 cut(s)	80, 258, 281
HpyF3I	CTNAG	1 cut(s)	216
Kzo9I	GATC	1 cut(s)	228
LmnI	GCTCC	1 cut(s)	23
LweI	GCATC	1 cut(s)	268
MaeIII	GTNAC	1 cut(s)	89
MalI	GATC	1 cut(s)	230
MboI	GATC	1 cut(s)	228
MboII	GAAGA	5 cut(s)	33, 84, 87, 134, 198
MflI	RGATCY	1 cut(s)	228
MnlI	CCTC	5 cut(s)	4, 167, 212, 293, 302
MspR9I	CCNGG	2 cut(s)	222, 233
MvaI	CCWGG	2 cut(s)	222, 233
NdeII	GATC	1 cut(s)	228
NlaIV	GGNNCC	2 cut(s)	230, 246
NmuCI	GTSAC	1 cut(s)	89
PceI	AGGCCT	1 cut(s)	291
PflMI	CCANNNNNTGG	1 cut(s)	149
PpuMI	RGGWCCY	1 cut(s)	245
Psp5II	RGGWCCY	1 cut(s)	245
Psp6I	CCWGG	2 cut(s)	220, 231
PspGI	CCWGG	2 cut(s)	220, 231
PspN4I	GGNNCC	2 cut(s)	230, 246
PspPI	GGNCC	1 cut(s)	245
PspPPI	RGGWCCY	1 cut(s)	245
PsuI	RGATCY	1 cut(s)	228
Sau3AI	GATC	1 cut(s)	228
Sau96I	GGNCC	1 cut(s)	245
ScrFI	CCNGG	2 cut(s)	222, 233
SetI	ASST	2 cut(s)	28, 91
SfaNI	GCATC	1 cut(s)	268
SinI	GGWCC	1 cut(s)	245
SseBI	AGGCCT	1 cut(s)	291
SsiI	CCGC	1 cut(s)	69
StuI	AGGCCT	1 cut(s)	291
StyD4I	CCNGG	2 cut(s)	220, 231
TscAI	CASTG	1 cut(s)	211
TseFI	GTSAC	1 cut(s)	89
Tsp45I	GTSAC	1 cut(s)	89
TspRI	CASTG	1 cut(s)	211
Van91I	CCANNNNNTGG	1 cut(s)	149
VpaK11BI	GGWCC	1 cut(s)	245

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.