Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000355.1

Orthogroup ID

OG0007245

Physical Location & Seq

Genomic Coordinates Forward (+)

125892 .. 128103

Gene Structure 2212 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000355.1_g000030.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1101 bp

atggctggtactggtttgtttacagagatattggatggagaagcctacaagtactactccgatggagaatggaagaaatcatcttctggtaaacttgttcccatcatcaacccaactacaagaaaggttcactacaaggttcaagcttgtacacaagaagaggtcaacaaggtgatggagtcagcaaaaactgcacagaagttatgggcaaagactccactttggaagagagcagagctacttcacaaggctgcttctatcctcaaggaacaaaaagctccaattgcggagtgtttggttaaagagattgctaagcctgctaaagatgctgttacggaggttgtcaggtctggagatttgatctcttacactgctgaagaaggggtcaggatccttggtgaagggaagttcttgttgtctgatagttttcctggaaatgaaagaaccaagtactgcctcacttccaagattccacttggtgtggttctagccattccaccatttaactatcctgtcaaccttgccgtctcaaaaattgctccggcattgattgctggaaactctcttgtgctcaaacccccaactcagggtgctgtttctgcccttcatatggtacattgttttcacttggctggtttccccaaaggccttattagctgtgtcactgggaaaggatctgagataggtgacttccttaccatgcaccccggagtgaattgtattagcttcactggtggtgacaccggtgttgcaatttccaaaaaggcaggcatgatccctcttcagatggagttgggaggaaaagatgcctgcattgtgcttgaagatgctgatcttgatttggtggccgtaaacataataaaaggaggcttttcctacagtggtcagagatgtactgctgtcaaggttgtgttggtgatggaatctgttgctgatgccctggttgagaaagtgaaggccaaggtggcaaagttaaccgtcgggccacccgaggagaactgtgacatcactccagttgtgacggaatcatctgcaaactatatcgaagggttggttatggatgcaaaacagaaagaagcaacattttgccaggagtacaga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00010 ko00030 ko01100 ko01120 ko01200 map00010 map00030 map01100 map01120 map01200

Pfam Domains

Protein Families

Aldedh

Protein Analysis

367

Amino Acids

39.36

Weight (kDa)

7.94

Isoelectric Point (pI)

39.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007245)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G24270 AT2G24270 AT2G24270 AT2G24270
fragaria_vesca	FvH4_1g01130 FvH4_1g01130
malus_domestica	MD02G1009300.v1.1 MD15G1154800.v1.1
prunus_persica	Prupe.7G260700_v2.0.a1 Prupe.7G260700_v2.0.a1 Prupe.7G260700_v2.0.a1
pyrus_communis	pycom02g00830 pycom15g13830
rosa_chinensis	RchiOBHm_Chr2g0085921
rosa_laevigata	RLG00000015727
rosa_multiflora	Rmu_sc0001748.1_g000003 Rmu_ssc0000355.1_g000030
rosa_roxburghii	Rroxscaffold_2G00154930
rosa_rugosa	Rorug01G0464300 Rorug01G0464400
rosa_samantha	Rh2AG013300 Rh2BG014000 Rh2CG014500 Rh2DG015800
rosa_wichuraiana	Rw2G001190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	287
AclWI	GGATC	4 cut(s)	385, 398, 682, 769
AcoI	YGGCCR	1 cut(s)	846
AcuI	CTGAAG	2 cut(s)	396, 767
AdeI	CACNNNGTG	1 cut(s)	479
AfaI	GTAC	7 cut(s)	10, 53, 151, 452, 615, 895, 1097
AfiI	CCNNNNNNNGG	3 cut(s)	586, 587, 610
AgeI	ACCGGT	1 cut(s)	743
AgsI	TTSAA	2 cut(s)	143, 824
AjnI	CCWGG	3 cut(s)	430, 939, 1089
AluBI	AGCT	5 cut(s)	146, 238, 278, 657, 726
AluI	AGCT	5 cut(s)	146, 238, 278, 657, 726
Alw21I	GWGCWC	1 cut(s)	573
Alw26I	GTCTC	1 cut(s)	532
AlwI	GGATC	4 cut(s)	385, 398, 682, 769
Ama87I	CYCGRG	1 cut(s)	989
AoxI	GGCC	4 cut(s)	646, 846, 957, 983
ApeKI	GCWGC	1 cut(s)	251
AsiGI	ACCGGT	1 cut(s)	743
AspS9I	GGNCC	1 cut(s)	983
AsuC2I	CCSGG	1 cut(s)	708
AsuHPI	GGTGA	5 cut(s)	184, 410, 698, 749, 928
AvaI	CYCGRG	1 cut(s)	989
BamHI	GGATCC	1 cut(s)	390
Bbv12I	GWGCWC	1 cut(s)	573
BbvI	GCAGC	1 cut(s)	238
BccI	CCATC	6 cut(s)	29, 56, 110, 169, 781, 913
BceAI	ACGGC	2 cut(s)	509, 833
BciT130I	CCWGG	3 cut(s)	432, 941, 1091
BcnI	CCSGG	1 cut(s)	708
BcoDI	GTCTC	1 cut(s)	532
BfaI	CTAG	1 cut(s)	488
BfmI	CTRYAG	1 cut(s)	877
BglI	GCCNNNNNGGC	1 cut(s)	965
BisI	GCNGC	1 cut(s)	252
BlpI	GCTNAGC	1 cut(s)	312
BlsI	GCNGC	1 cut(s)	253
BmcAI	AGTACT	2 cut(s)	53, 452
Bme1390I	CCNGG	4 cut(s)	432, 708, 941, 1091
BmeT110I	CYCGRG	1 cut(s)	989
BmgT120I	GGNCC	1 cut(s)	983
BmiI	GGNNCC	1 cut(s)	392
BmrFI	CCNGG	4 cut(s)	432, 708, 941, 1091
BmrI	ACTGGG	1 cut(s)	675
BmsI	GCATC	5 cut(s)	316, 796, 817, 925, 1051
BmuI	ACTGGG	1 cut(s)	675
BpmI	CTGGAG	2 cut(s)	372, 996
Bpu1102I	GCTNAGC	1 cut(s)	312
BpuEI	CTTGAG	1 cut(s)	248
BpuMI	CCSGG	1 cut(s)	708
BsaBI	GATNNNNATC	1 cut(s)	831
BsaJI	CCNNGG	5 cut(s)	394, 706, 939, 960, 990
BsaWI	WCCGGW	1 cut(s)	743
Bsc4I	CCNNNNNNNGG	3 cut(s)	586, 587, 610
Bse118I	RCCGGY	1 cut(s)	743
Bse1I	ACTGG	4 cut(s)	16, 670, 736, 1013
Bse8I	GATNNNNATC	1 cut(s)	831
BseBI	CCWGG	3 cut(s)	432, 941, 1091
BseDI	CCNNGG	5 cut(s)	394, 706, 939, 960, 990
BseGI	GGATG	2 cut(s)	40, 1066
BseJI	GATNNNNATC	1 cut(s)	831
BseLI	CCNNNNNNNGG	3 cut(s)	586, 587, 610
BseMII	CTCAG	2 cut(s)	599, 669
BseNI	ACTGG	4 cut(s)	16, 670, 736, 1013
BseRI	GAGGAG	1 cut(s)	1007
BseXI	GCAGC	1 cut(s)	238
BsgI	GTGCAG	1 cut(s)	177
BshFI	GGCC	4 cut(s)	648, 848, 959, 985
BshTI	ACCGGT	1 cut(s)	743
BsiHKAI	GWGCWC	1 cut(s)	573
BsiHKCI	CYCGRG	1 cut(s)	989
BsiSI	CCGG	3 cut(s)	542, 708, 744
BslI	CCNNNNNNNGG	3 cut(s)	586, 587, 610
BsmAI	GTCTC	1 cut(s)	532
BsmBI	CGTCTC	1 cut(s)	532
BsnI	GGCC	4 cut(s)	648, 848, 959, 985
BsoBI	CYCGRG	1 cut(s)	989
Bsp1286I	GDGCHC	1 cut(s)	573
Bsp1407I	TGTACA	1 cut(s)	149
Bsp143I	GATC	5 cut(s)	360, 390, 674, 774, 832
Bsp1720I	GCTNAGC	1 cut(s)	312
BspACI	CCGC	1 cut(s)	287
BspANI	GGCC	4 cut(s)	648, 848, 959, 985
BspCNI	CTCAG	2 cut(s)	598, 670
BspLI	GGNNCC	1 cut(s)	392
BspPI	GGATC	4 cut(s)	385, 398, 682, 769
BsrFI	RCCGGY	1 cut(s)	743
BsrGI	TGTACA	1 cut(s)	149
BsrI	ACTGG	4 cut(s)	16, 670, 736, 1013
BssAI	RCCGGY	1 cut(s)	743
BssECI	CCNNGG	5 cut(s)	394, 706, 939, 960, 990
BssMI	GATC	5 cut(s)	360, 390, 674, 774, 832
BssT1I	CCWWGG	2 cut(s)	394, 960
Bst2UI	CCWGG	3 cut(s)	432, 941, 1091
Bst4CI	ACNGT	3 cut(s)	881, 979, 1001
Bst6I	CTCTTC	3 cut(s)	153, 221, 786
BstAPI	GCANNNNNTGC	2 cut(s)	191, 551
BstAUI	TGTACA	1 cut(s)	149
BstC8I	GCNNGC	3 cut(s)	318, 769, 811
BstDEI	CTNAG	3 cut(s)	312, 585, 678
BstF5I	GGATG	2 cut(s)	40, 1066
BstKTI	GATC	5 cut(s)	363, 393, 677, 777, 835
BstMAI	GTCTC	1 cut(s)	532
BstMBI	GATC	5 cut(s)	360, 390, 674, 774, 832
BstMWI	GCNNNNNNNGC	8 cut(s)	191, 284, 317, 326, 551, 599, 654, 965
BstNI	CCWGG	3 cut(s)	432, 941, 1091
BstSCI	CCNGG	4 cut(s)	430, 706, 939, 1089
BstSFI	CTRYAG	1 cut(s)	877
BstV1I	GCAGC	1 cut(s)	238
BstX2I	RGATCY	2 cut(s)	390, 674
BstYI	RGATCY	2 cut(s)	390, 674
BsuRI	GGCC	4 cut(s)	648, 848, 959, 985
BtsCI	GGATG	2 cut(s)	40, 1066
BtsI	GCAGTG	1 cut(s)	369
BtsIMutI	CAGTG	4 cut(s)	369, 663, 729, 886
Cac8I	GCNNGC	3 cut(s)	318, 769, 811
Cfr10I	RCCGGY	1 cut(s)	743
Cfr13I	GGNCC	1 cut(s)	983
Csp6I	GTAC	7 cut(s)	9, 52, 150, 451, 614, 894, 1096
CspAI	ACCGGT	1 cut(s)	743
CviAII	CATG	2 cut(s)	700, 772
CviQI	GTAC	7 cut(s)	9, 52, 150, 451, 614, 894, 1096
DdeI	CTNAG	3 cut(s)	312, 585, 678
DpnI	GATC	5 cut(s)	362, 392, 676, 776, 834
DpnII	GATC	5 cut(s)	360, 390, 674, 774, 832
DraIII	CACNNNGTG	1 cut(s)	479
EaeI	YGGCCR	1 cut(s)	846
Eam1104I	CTCTTC	3 cut(s)	153, 221, 786
EarI	CTCTTC	3 cut(s)	153, 221, 786
Eco130I	CCWWGG	2 cut(s)	394, 960
Eco147I	AGGCCT	1 cut(s)	648
Eco57I	CTGAAG	2 cut(s)	396, 767
Eco88I	CYCGRG	1 cut(s)	989
EcoRII	CCWGG	3 cut(s)	430, 939, 1089
EcoT14I	CCWWGG	2 cut(s)	394, 960
ErhI	CCWWGG	2 cut(s)	394, 960
Esp3I	CGTCTC	1 cut(s)	532
FaeI	CATG	2 cut(s)	703, 775
FaiI	YATR	8 cut(s)	205, 609, 611, 701, 773, 857, 1041, 1058
FatI	CATG	2 cut(s)	699, 771
FauNDI	CATATG	1 cut(s)	609
Fnu4HI	GCNGC	1 cut(s)	252
FokI	GGATG	2 cut(s)	47, 1073
Fsp4HI	GCNGC	1 cut(s)	252
FspBI	CTAG	1 cut(s)	488
GluI	GCNGC	1 cut(s)	252
GsuI	CTGGAG	2 cut(s)	372, 996
HaeIII	GGCC	4 cut(s)	648, 848, 959, 985
HapII	CCGG	3 cut(s)	542, 708, 744
Hin1II	CATG	2 cut(s)	703, 775
HincII	GTYRAC	3 cut(s)	166, 517, 975
HindII	GTYRAC	3 cut(s)	166, 517, 975
HindIII	AAGCTT	1 cut(s)	144
HinfI	GANTC	5 cut(s)	179, 214, 469, 923, 1025
HpaI	GTTAAC	1 cut(s)	975
HpaII	CCGG	3 cut(s)	542, 708, 744
HphI	GGTGA	5 cut(s)	184, 410, 698, 749, 928
Hpy166II	GTNNAC	8 cut(s)	21, 92, 130, 152, 166, 517, 853, 975
Hpy188I	TCNGA	5 cut(s)	61, 421, 679, 786, 888
Hpy188III	TCNNGA	3 cut(s)	351, 388, 836
Hpy8I	GTNNAC	8 cut(s)	21, 92, 130, 152, 166, 517, 853, 975
Hpy99I	CGWCG	1 cut(s)	983
HpyAV	CCTTC	5 cut(s)	374, 395, 614, 949, 1040
HpyCH4III	ACNGT	3 cut(s)	881, 979, 1001
HpyCH4V	TGCA	6 cut(s)	194, 703, 752, 813, 1034, 1064
HpyF10VI	GCNNNNNNNGC	8 cut(s)	191, 284, 317, 326, 551, 599, 654, 965
HpyF3I	CTNAG	3 cut(s)	312, 585, 678
Hsp92II	CATG	2 cut(s)	703, 775
KspAI	GTTAAC	1 cut(s)	975
Kzo9I	GATC	5 cut(s)	360, 390, 674, 774, 832
LmnI	GCTCC	2 cut(s)	283, 544
Lsp1109I	GCAGC	1 cut(s)	238
LweI	GCATC	5 cut(s)	316, 796, 817, 925, 1051
MaeI	CTAG	1 cut(s)	488
MaeIII	GTNAC	6 cut(s)	331, 661, 686, 737, 1001, 1018
MalI	GATC	5 cut(s)	362, 392, 676, 776, 834
MboI	GATC	5 cut(s)	360, 390, 674, 774, 832
MboII	GAAGA	7 cut(s)	75, 85, 170, 238, 389, 773, 836
MfeI	CAATTG	1 cut(s)	282
MflI	RGATCY	2 cut(s)	390, 674
MhlI	GDGCHC	1 cut(s)	573
MluCI	AATT	4 cut(s)	282, 534, 715, 753
MlyI	GAGTC	2 cut(s)	188, 208
MnlI	CCTC	8 cut(s)	154, 272, 331, 467, 789, 791, 860, 985
MseI	TTAA	3 cut(s)	300, 504, 974
MspI	CCGG	3 cut(s)	542, 708, 744
MspR9I	CCNGG	4 cut(s)	432, 708, 941, 1091
MunI	CAATTG	1 cut(s)	282
MvaI	CCWGG	3 cut(s)	432, 941, 1091
MwoI	GCNNNNNNNGC	8 cut(s)	191, 284, 317, 326, 551, 599, 654, 965
NciI	CCSGG	1 cut(s)	708
NdeI	CATATG	1 cut(s)	609
NdeII	GATC	5 cut(s)	360, 390, 674, 774, 832
NlaIII	CATG	2 cut(s)	703, 775
NlaIV	GGNNCC	1 cut(s)	392
NmuCI	GTSAC	5 cut(s)	661, 686, 737, 1001, 1018
PceI	AGGCCT	1 cut(s)	648
PcsI	WCGNNNNNNNCGW	1 cut(s)	987
PfeI	GAWTC	3 cut(s)	469, 923, 1025
PfoI	TCCNGGA	1 cut(s)	430
PinAI	ACCGGT	1 cut(s)	743
PkrI	GCNGC	1 cut(s)	253
PleI	GAGTC	2 cut(s)	187, 208
PpsI	GAGTC	2 cut(s)	187, 208
Psp6I	CCWGG	3 cut(s)	430, 939, 1089
PspGI	CCWGG	3 cut(s)	430, 939, 1089
PspN4I	GGNNCC	1 cut(s)	392
PspPI	GGNCC	1 cut(s)	983
PsuI	RGATCY	2 cut(s)	390, 674
RsaI	GTAC	7 cut(s)	10, 53, 151, 452, 615, 895, 1097
RsaNI	GTAC	7 cut(s)	9, 52, 150, 451, 614, 894, 1096
SaqAI	TTAA	3 cut(s)	300, 504, 974
SatI	GCNGC	1 cut(s)	252
Sau3AI	GATC	5 cut(s)	360, 390, 674, 774, 832
Sau96I	GGNCC	1 cut(s)	983
ScaI	AGTACT	2 cut(s)	53, 452
SchI	GAGTC	2 cut(s)	188, 208
ScrFI	CCNGG	4 cut(s)	432, 708, 941, 1091
SduI	GDGCHC	1 cut(s)	573
SfaNI	GCATC	5 cut(s)	316, 796, 817, 925, 1051
SfcI	CTRYAG	1 cut(s)	877
SgrAI	CRCCGGYG	1 cut(s)	743
SmlI	CTYRAG	1 cut(s)	263
SmoI	CTYRAG	1 cut(s)	263
Sse9I	AATT	4 cut(s)	282, 534, 715, 753
SseBI	AGGCCT	1 cut(s)	648
SsiI	CCGC	1 cut(s)	287
SspMI	CTAG	1 cut(s)	488
StuI	AGGCCT	1 cut(s)	648
StyD4I	CCNGG	4 cut(s)	430, 706, 939, 1089
StyI	CCWWGG	2 cut(s)	394, 960
TaaI	ACNGT	3 cut(s)	881, 979, 1001
TaqI	TCGA	1 cut(s)	1044
TasI	AATT	4 cut(s)	282, 534, 715, 753
TatI	WGTACW	5 cut(s)	51, 149, 450, 893, 1095
TfiI	GAWTC	3 cut(s)	469, 923, 1025
Tru1I	TTAA	3 cut(s)	300, 504, 974
Tru9I	TTAA	3 cut(s)	300, 504, 974
TscAI	CASTG	4 cut(s)	376, 670, 736, 886
TseFI	GTSAC	5 cut(s)	661, 686, 737, 1001, 1018
TseI	GCWGC	1 cut(s)	251
Tsp45I	GTSAC	5 cut(s)	661, 686, 737, 1001, 1018
TspDTI	ATGAA	2 cut(s)	453, 596
TspGWI	ACGGA	2 cut(s)	350, 1037
TspRI	CASTG	4 cut(s)	376, 670, 736, 886
XspI	CTAG	1 cut(s)	488
ZrmI	AGTACT	2 cut(s)	53, 452

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.