Rmu_ssc0000460.1_g000033

Thaumatin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000460.1
OG0010716
Physical Location & Seq
Forward (+)
156822 .. 157883
1062 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000460.1_g000033.1.cds

Sequence Viewer

Length: 1062 bp
atgtcgatctttcgttgccctctacaaatcattctcattgtttcgctcattagttttcaaaccagcgttaattcgacaacttttacattcacaaacaggtgcgattacactgtttatcccggaactctagccggttcatccagccctagactagaaagcaccggattccagctccaacccggcgagtctcgctcccttcaagccccaccaagctggtccggcaggttctggggtcgaaccggttgcaacttcgaccccgtcacaggccagggctcctgcaccaccgccgactgcggctccaaccaactcgagtgcaacggcgccggtgcagtccctcccgccactctcgccgagttcacaatcggctcgggtgatgcaaaggacttctacgacgtcagtctggtggatggcttcaacttgcctatgctggtcgaaccgagcggcggctccggtgactgttcttcaaccgcgtgcgcggtgaacttgaataagggatgtccgagtgagctgcagttcgaaggcggggcggggtgtagaagcgcgtgcgaggcttttcagacgccggaatactgctgcagtggcgcgtatggctcaccgtcgacatgtaagccgtcggtttactcgcagatgtttaaggcggcgtgtccgacggcgtatagctatgcgtacgatgatggcacgagtaccttcacgtgtagtggagctgattacatcataacattctgcccctcatctacaacaagtcttaaatcttcaacaccaacaacttcaacacttccaacatcaccaacaacgatgccgacacaaacagcaccatcagtatcaccaccaacaatgacaccaccaaggccaacgacgacggtaacaccgccactgccaacagggacaacggcgacatcaacagcaccggcaacaccaacgagggcaacagatgggaccggaggtggatatgtcatggattattttggttcatcgccgagttttagtggcgacgcatccaagacagttgcttctattgccatggctgcttcttctgttttgttttattttctattggtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0009605 GO:0009607 GO:0009617 GO:0009719 GO:0009723 GO:0009725 GO:0010033 GO:0042221 GO:0043207 GO:0050896 GO:0051704 GO:0051707
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thaumatin

Protein Analysis

353

Amino Acids

36.49

Weight (kDa)

4.5

Isoelectric Point (pI)

53.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010716)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G24180 AT4G24180 AT4G24180 AT4G24180 AT4G24180 AT4G24180
fragaria_vesca FvH4_2g38310
malus_domestica MD08G1011400.v1.1
prunus_persica Prupe.1G364000_v2.0.a1
pyrus_communis pycom08g01000
rosa_chinensis RchiOBHm_Chr6g0303061
rosa_laevigata RLG00000011112
rosa_multiflora Rmu_ssc0000460.1_g000033
rosa_roxburghii Rroxscaffold_7G00165070
rosa_rugosa Rorug06G0319100
rosa_samantha Rh6AG432600 Rh6BG470000 Rh6CG445000 Rh6DG431800
rosa_wichuraiana Rw6G037500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 396
Acc36I ACCTGC 1 cut(s) 213
AccB1I GGYRCC 1 cut(s) 320
AccBSI CCGCTC 1 cut(s) 441
AccI GTMKAC 1 cut(s) 599
AccII CGCG 4 cut(s) 470, 476, 542, 584
AcvI CACGTG 1 cut(s) 693
AcyI GRCGYC 3 cut(s) 321, 393, 560
AfaI GTAC 2 cut(s) 668, 685
AfiI CCNNNNNNNGG 2 cut(s) 263, 443
AflIII ACRYGT 2 cut(s) 602, 692
AgeI ACCGGT 1 cut(s) 239
AgsI TTSAA 7 cut(s) 59, 200, 415, 465, 487, 756, 771
AjnI CCWGG 1 cut(s) 267
AluBI AGCT 5 cut(s) 172, 213, 508, 660, 704
AluI AGCT 5 cut(s) 172, 213, 508, 660, 704
Alw26I GTCTC 1 cut(s) 192
AlwNI CAGNNNCTG 1 cut(s) 228
Ama87I CYCGRG 2 cut(s) 308, 367
AoxI GGCC 2 cut(s) 265, 848
ApeKI GCWGC 3 cut(s) 508, 573, 1025
AsiGI ACCGGT 1 cut(s) 239
AspLEI GCGC 4 cut(s) 323, 476, 542, 584
AspS9I GGNCC 2 cut(s) 216, 936
AsuC2I CCSGG 2 cut(s) 120, 180
AsuHPI GGTGA 6 cut(s) 383, 464, 490, 585, 777, 816
AsuII TTCGAA 1 cut(s) 516
AvaI CYCGRG 2 cut(s) 308, 367
AvaII GGWCC 2 cut(s) 216, 936
BanI GGYRCC 1 cut(s) 320
BanII GRGCYC 1 cut(s) 275
BauI CACGAG 1 cut(s) 679
BbrPI CACGTG 1 cut(s) 693
BbvI GCAGC 3 cut(s) 495, 560, 1012
BccI CCATC 4 cut(s) 401, 668, 823, 926
BceAI ACGGC 4 cut(s) 334, 595, 666, 906
BcgI CGANNNNNNTGC 4 cut(s) 225, 259, 490, 524
BciT130I CCWGG 1 cut(s) 269
BcnI CCSGG 2 cut(s) 120, 180
BcoDI GTCTC 1 cut(s) 192
BfaI CTAG 3 cut(s) 128, 147, 152
BfmI CTRYAG 2 cut(s) 509, 574
BfoI RGCGCY 1 cut(s) 324
BfuAI ACCTGC 1 cut(s) 213
BisI GCNGC 7 cut(s) 295, 442, 445, 509, 574, 639, 1026
BlsI GCNGC 7 cut(s) 296, 443, 446, 510, 575, 640, 1027
Bme1390I CCNGG 3 cut(s) 120, 180, 269
Bme18I GGWCC 2 cut(s) 216, 936
BmeT110I CYCGRG 2 cut(s) 308, 367
BmgT120I GGNCC 2 cut(s) 216, 936
BmiI GGNNCC 5 cut(s) 274, 298, 322, 448, 937
BmrFI CCNGG 3 cut(s) 120, 180, 269
BmsI GCATC 3 cut(s) 364, 786, 1004
BoxI GACNNNNGTC 1 cut(s) 396
BplI GAGNNNNNCTC 2 cut(s) 176, 208
Bpu14I TTCGAA 1 cut(s) 516
BpuMI CCSGG 2 cut(s) 120, 180
BsaAI YACGTR 1 cut(s) 693
BsaHI GRCGYC 3 cut(s) 321, 393, 560
BsaJI CCNNGG 3 cut(s) 268, 845, 1020
BsaWI WCCGGW 4 cut(s) 161, 239, 449, 938
BsaXI ACNNNNNCTCC 2 cut(s) 281, 311
Bsc4I CCNNNNNNNGG 2 cut(s) 263, 443
Bse118I RCCGGY 4 cut(s) 131, 239, 323, 907
BseBI CCWGG 1 cut(s) 269
BseDI CCNNGG 3 cut(s) 268, 845, 1020
BseGI GGATG 4 cut(s) 137, 412, 500, 995
BseLI CCNNNNNNNGG 2 cut(s) 263, 443
BseXI GCAGC 3 cut(s) 495, 560, 1012
BsgI GTGCAG 2 cut(s) 262, 348
Bsh1236I CGCG 4 cut(s) 470, 476, 542, 584
BshFI GGCC 2 cut(s) 267, 850
BshNI GGYRCC 1 cut(s) 320
BshTI ACCGGT 1 cut(s) 239
BsiHKCI CYCGRG 2 cut(s) 308, 367
BsiWI CGTACG 1 cut(s) 666
BslFI GGGAC 3 cut(s) 317, 898, 949
BslI CCNNNNNNNGG 2 cut(s) 263, 443
BsmAI GTCTC 1 cut(s) 192
BsmFI GGGAC 3 cut(s) 317, 898, 949
BsnI GGCC 2 cut(s) 267, 850
BsoBI CYCGRG 2 cut(s) 308, 367
Bsp119I TTCGAA 1 cut(s) 516
Bsp1286I GDGCHC 1 cut(s) 275
Bsp143I GATC 1 cut(s) 6
Bsp19I CCATGG 1 cut(s) 1020
BspANI GGCC 2 cut(s) 267, 850
BspFNI CGCG 4 cut(s) 470, 476, 542, 584
BspLI GGNNCC 5 cut(s) 274, 298, 322, 448, 937
BspMAI CTGCAG 2 cut(s) 513, 578
BspMI ACCTGC 1 cut(s) 213
BspT104I TTCGAA 1 cut(s) 516
BspT107I GGYRCC 1 cut(s) 320
BsrBI CCGCTC 1 cut(s) 441
BsrFI RCCGGY 4 cut(s) 131, 239, 323, 907
BssAI RCCGGY 4 cut(s) 131, 239, 323, 907
BssECI CCNNGG 3 cut(s) 268, 845, 1020
BssMI GATC 1 cut(s) 6
BssNI GRCGYC 3 cut(s) 321, 393, 560
BssSI CACGAG 1 cut(s) 679
BssT1I CCWWGG 2 cut(s) 845, 1020
Bst2BI CACGAG 1 cut(s) 679
Bst2UI CCWGG 1 cut(s) 269
Bst4CI ACNGT 5 cut(s) 112, 458, 597, 862, 1006
BstACI GRCGYC 3 cut(s) 321, 393, 560
BstBAI YACGTR 1 cut(s) 693
BstBI TTCGAA 1 cut(s) 516
BstC8I GCNNGC 2 cut(s) 472, 544
BstDSI CCRYGG 1 cut(s) 1020
BstF5I GGATG 4 cut(s) 137, 412, 500, 995
BstFNI CGCG 4 cut(s) 470, 476, 542, 584
BstH2I RGCGCY 1 cut(s) 324
BstHHI GCGC 4 cut(s) 323, 476, 542, 584
BstKTI GATC 1 cut(s) 9
BstMAI GTCTC 1 cut(s) 192
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 8 cut(s) 189, 219, 347, 548, 579, 588, 1016, 1025
BstNI CCWGG 1 cut(s) 269
BstNSI RCATGY 1 cut(s) 606
BstPAI GACNNNNGTC 1 cut(s) 396
BstSCI CCNGG 3 cut(s) 118, 178, 267
BstSFI CTRYAG 2 cut(s) 509, 574
BstUI CGCG 4 cut(s) 470, 476, 542, 584
BstV1I GCAGC 3 cut(s) 495, 560, 1012
BstXI CCANNNNNNTGG 1 cut(s) 213
BsuRI GGCC 2 cut(s) 267, 850
BtgI CCRYGG 1 cut(s) 1020
BtgZI GCGATG 1 cut(s) 957
BtsCI GGATG 4 cut(s) 137, 412, 500, 995
BtsI GCAGTG 2 cut(s) 583, 872
BtsIMutI CAGTG 3 cut(s) 108, 583, 872
BveI ACCTGC 1 cut(s) 213
Cac8I GCNNGC 2 cut(s) 472, 544
CaiI CAGNNNCTG 1 cut(s) 228
CfoI GCGC 4 cut(s) 323, 476, 542, 584
Cfr10I RCCGGY 4 cut(s) 131, 239, 323, 907
Cfr13I GGNCC 2 cut(s) 216, 936
CseI GACGC 2 cut(s) 568, 1001
Csp6I GTAC 2 cut(s) 667, 684
CspAI ACCGGT 1 cut(s) 239
CviAII CATG 3 cut(s) 603, 955, 1021
CviQI GTAC 2 cut(s) 667, 684
DinI GGCGCC 1 cut(s) 322
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Eco130I CCWWGG 2 cut(s) 845, 1020
Eco24I GRGCYC 1 cut(s) 275
Eco47I GGWCC 2 cut(s) 216, 936
Eco72I CACGTG 1 cut(s) 693
Eco88I CYCGRG 2 cut(s) 308, 367
EcoRII CCWGG 1 cut(s) 267
EcoT14I CCWWGG 2 cut(s) 845, 1020
EcoT38I GRGCYC 1 cut(s) 275
EgeI GGCGCC 1 cut(s) 322
EheI GGCGCC 1 cut(s) 322
ErhI CCWWGG 2 cut(s) 845, 1020
FaeI CATG 3 cut(s) 606, 958, 1024
FaiI YATR 9 cut(s) 425, 588, 604, 657, 663, 716, 951, 956, 1022
FaqI GGGAC 3 cut(s) 317, 898, 949
FatI CATG 3 cut(s) 602, 954, 1020
FauI CCCGC 3 cut(s) 346, 515, 520
FblI GTMKAC 1 cut(s) 599
Fnu4HI GCNGC 7 cut(s) 295, 442, 445, 509, 574, 639, 1026
FokI GGATG 4 cut(s) 124, 419, 507, 982
FriOI GRGCYC 1 cut(s) 275
Fsp4HI GCNGC 7 cut(s) 295, 442, 445, 509, 574, 639, 1026
FspBI CTAG 3 cut(s) 128, 147, 152
GlaI GCGC 4 cut(s) 322, 475, 541, 583
GluI GCNGC 7 cut(s) 295, 442, 445, 509, 574, 639, 1026
HaeII RGCGCY 1 cut(s) 324
HaeIII GGCC 2 cut(s) 267, 850
HgaI GACGC 2 cut(s) 568, 1001
HhaI GCGC 4 cut(s) 323, 476, 542, 584
Hin1I GRCGYC 3 cut(s) 321, 393, 560
Hin1II CATG 3 cut(s) 606, 958, 1024
Hin6I GCGC 4 cut(s) 321, 474, 540, 582
HinP1I GCGC 4 cut(s) 321, 474, 540, 582
HincII GTYRAC 1 cut(s) 600
HindII GTYRAC 1 cut(s) 600
HinfI GANTC 2 cut(s) 165, 185
HphI GGTGA 6 cut(s) 383, 464, 490, 585, 777, 816
Hpy166II GTNNAC 4 cut(s) 357, 481, 600, 619
Hpy188I TCNGA 3 cut(s) 501, 558, 648
Hpy8I GTNNAC 4 cut(s) 357, 481, 600, 619
Hpy99I CGWCG 7 cut(s) 395, 601, 616, 652, 859, 862, 995
HpyAV CCTTC 3 cut(s) 206, 512, 697
HpyCH4III ACNGT 5 cut(s) 112, 458, 597, 862, 1006
HpyCH4IV ACGT 2 cut(s) 393, 692
HpyCH4V TGCA 7 cut(s) 246, 279, 315, 329, 377, 511, 576
HpyF10VI GCNNNNNNNGC 8 cut(s) 189, 219, 347, 548, 579, 588, 1016, 1025
HpySE526I ACGT 2 cut(s) 393, 692
Hsp92I GRCGYC 3 cut(s) 321, 393, 560
Hsp92II CATG 3 cut(s) 606, 958, 1024
HspAI GCGC 4 cut(s) 321, 474, 540, 582
KasI GGCGCC 1 cut(s) 320
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 6 cut(s) 177, 197, 278, 302, 452, 701
Lsp1109I GCAGC 3 cut(s) 495, 560, 1012
LweI GCATC 3 cut(s) 364, 786, 1004
MaeI CTAG 3 cut(s) 128, 147, 152
MaeII ACGT 2 cut(s) 393, 692
MaeIII GTNAC 3 cut(s) 259, 452, 862
MalI GATC 1 cut(s) 8
MbiI CCGCTC 1 cut(s) 441
MboI GATC 1 cut(s) 6
MboII GAAGA 3 cut(s) 453, 744, 1023
MhlI GDGCHC 1 cut(s) 275
MluCI AATT 1 cut(s) 70
Mly113I GGCGCC 1 cut(s) 321
MlyI GAGTC 1 cut(s) 194
MmeI TCCRAC 4 cut(s) 199, 324, 671, 803
MnlI CCTC 6 cut(s) 30, 345, 541, 739, 915, 935
MseI TTAA 3 cut(s) 69, 633, 747
MspR9I CCNGG 3 cut(s) 120, 180, 269
MvaI CCWGG 1 cut(s) 269
MvnI CGCG 4 cut(s) 470, 476, 542, 584
MwoI GCNNNNNNNGC 8 cut(s) 189, 219, 347, 548, 579, 588, 1016, 1025
NarI GGCGCC 1 cut(s) 321
NciI CCSGG 2 cut(s) 120, 180
NcoI CCATGG 1 cut(s) 1020
NdeII GATC 1 cut(s) 6
NlaIII CATG 3 cut(s) 606, 958, 1024
NlaIV GGNNCC 5 cut(s) 274, 298, 322, 448, 937
NmeAIII GCCGAG 2 cut(s) 376, 1002
NmuCI GTSAC 2 cut(s) 259, 452
NspI RCATGY 1 cut(s) 606
NspV TTCGAA 1 cut(s) 516
PaeR7I CTCGAG 1 cut(s) 308
PciI ACATGT 1 cut(s) 602
PfeI GAWTC 1 cut(s) 165
Pfl23II CGTACG 1 cut(s) 666
PflFI GACNNNGTC 1 cut(s) 257
PfoI TCCNGGA 1 cut(s) 118
PinAI ACCGGT 1 cut(s) 239
PkrI GCNGC 7 cut(s) 296, 443, 446, 510, 575, 640, 1027
PleI GAGTC 1 cut(s) 193
PluTI GGCGCC 1 cut(s) 324
PmaCI CACGTG 1 cut(s) 693
PmlI CACGTG 1 cut(s) 693
PpsI GAGTC 1 cut(s) 193
Ppu21I YACGTR 1 cut(s) 693
PscI ACATGT 1 cut(s) 602
PshAI GACNNNNGTC 1 cut(s) 396
Psp6I CCWGG 1 cut(s) 267
PspCI CACGTG 1 cut(s) 693
PspGI CCWGG 1 cut(s) 267
PspLI CGTACG 1 cut(s) 666
PspN4I GGNNCC 5 cut(s) 274, 298, 322, 448, 937
PspPI GGNCC 2 cut(s) 216, 936
PspXI VCTCGAGB 1 cut(s) 308
PstI CTGCAG 2 cut(s) 513, 578
PstNI CAGNNNCTG 1 cut(s) 228
PsyI GACNNNGTC 1 cut(s) 257
RsaI GTAC 2 cut(s) 668, 685
RsaNI GTAC 2 cut(s) 667, 684
SalI GTCGAC 1 cut(s) 598
SaqAI TTAA 3 cut(s) 69, 633, 747
SatI GCNGC 7 cut(s) 295, 442, 445, 509, 574, 639, 1026
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 2 cut(s) 216, 936
SchI GAGTC 1 cut(s) 194
ScrFI CCNGG 3 cut(s) 120, 180, 269
SduI GDGCHC 1 cut(s) 275
SfaNI GCATC 3 cut(s) 364, 786, 1004
SfcI CTRYAG 2 cut(s) 509, 574
SfoI GGCGCC 1 cut(s) 322
Sfr274I CTCGAG 1 cut(s) 308
SfuI TTCGAA 1 cut(s) 516
SgrAI CRCCGGYG 1 cut(s) 323
SinI GGWCC 2 cut(s) 216, 936
SlaI CTCGAG 1 cut(s) 308
SmlI CTYRAG 1 cut(s) 308
SmoI CTYRAG 1 cut(s) 308
Sse9I AATT 1 cut(s) 70
SspDI GGCGCC 1 cut(s) 320
SspMI CTAG 3 cut(s) 128, 147, 152
StyD4I CCNGG 3 cut(s) 118, 178, 267
StyI CCWWGG 2 cut(s) 845, 1020
TaaI ACNGT 5 cut(s) 112, 458, 597, 862, 1006
TaiI ACGT 2 cut(s) 396, 695
TaqI TCGA 8 cut(s) 5, 74, 235, 252, 309, 432, 516, 599
TasI AATT 1 cut(s) 70
TauI GCSGC 4 cut(s) 297, 444, 447, 641
TfiI GAWTC 1 cut(s) 165
Tru1I TTAA 3 cut(s) 69, 633, 747
Tru9I TTAA 3 cut(s) 69, 633, 747
TscAI CASTG 3 cut(s) 115, 583, 879
TseFI GTSAC 2 cut(s) 259, 452
TseI GCWGC 3 cut(s) 508, 573, 1025
Tsp45I GTSAC 2 cut(s) 259, 452
TspDTI ATGAA 2 cut(s) 126, 960
TspRI CASTG 3 cut(s) 115, 583, 879
Tth111I GACNNNGTC 1 cut(s) 257
VpaK11BI GGWCC 2 cut(s) 216, 936
XceI RCATGY 1 cut(s) 606
XhoI CTCGAG 1 cut(s) 308
XmiI GTMKAC 1 cut(s) 599
XspI CTAG 3 cut(s) 128, 147, 152
ZraI GACGTC 1 cut(s) 394
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.