Rroxscaffold_1G00005290
ERF Family

Belongs to the TRAFAC class dynamin-like GTPase superfamily. Dynamin Fzo YdjA family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
7214269 .. 7215436
1168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00005290.1

Sequence Viewer

Length: 309 bp
ATGACAGAGAAATCAAACCGTATTTCTAATGTTCCTATTCATCTCAGCATATACTCCCCAAATGTTGTCAATTTAACATTGATAGATTTGCCTGGCTTAACTAAGGTTGCTGTAGAGGGGCAGCCAGAGAGTATTGTTCAAGACATAGAAAATATGGTTCGTTCTTATATAGCAAAGCCTAACTGCATAATTCTAGCAATAACTCCTGCGAATCAAGACGTAGCAACATCAGATGCTATCAAGATCGCTAGAGAAGTTGATCCTACAGGCCCAATTATATACTATCTTAGAGCTGTGCCGGGCATTTGA

Protein Analysis

102

Amino Acids

11.08

Weight (kDa)

5.18

Isoelectric Point (pI)

39.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dynamin_N PF00350 3 - 92 2.6e-23 Dynamin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 254
AgsI TTSAA 1 cut(s) 140
AjnI CCWGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 293
AluI AGCT 1 cut(s) 293
AlwI GGATC 1 cut(s) 254
AoxI GGCC 1 cut(s) 268
ApeKI GCWGC 1 cut(s) 121
AspS9I GGNCC 1 cut(s) 269
AsuC2I CCSGG 1 cut(s) 300
BbvI GCAGC 1 cut(s) 133
BciT130I CCWGG 1 cut(s) 93
BcnI CCSGG 1 cut(s) 300
BfaI CTAG 2 cut(s) 194, 249
BfmI CTRYAG 2 cut(s) 111, 264
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
Bme1390I CCNGG 2 cut(s) 93, 300
BmgT120I GGNCC 1 cut(s) 269
BmrFI CCNGG 2 cut(s) 93, 300
BmsI GCATC 1 cut(s) 223
BpuMI CCSGG 1 cut(s) 300
BseBI CCWGG 1 cut(s) 93
BseMII CTCAG 1 cut(s) 58
BseXI GCAGC 1 cut(s) 133
BshFI GGCC 1 cut(s) 270
BsiSI CCGG 1 cut(s) 299
BsnI GGCC 1 cut(s) 270
Bsp143I GATC 2 cut(s) 243, 259
BspANI GGCC 1 cut(s) 270
BspCNI CTCAG 1 cut(s) 57
BspPI GGATC 1 cut(s) 254
BssMI GATC 2 cut(s) 243, 259
Bst2UI CCWGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 20
BstDEI CTNAG 3 cut(s) 44, 102, 287
BstKTI GATC 2 cut(s) 246, 262
BstMBI GATC 2 cut(s) 243, 259
BstNI CCWGG 1 cut(s) 93
BstSCI CCNGG 2 cut(s) 91, 298
BstSFI CTRYAG 2 cut(s) 111, 264
BstV1I GCAGC 1 cut(s) 133
BsuRI GGCC 1 cut(s) 270
Cfr13I GGNCC 1 cut(s) 269
CviJI RGCY 5 cut(s) 96, 124, 178, 270, 293
CviKI_1 RGCY 5 cut(s) 96, 124, 178, 270, 293
DdeI CTNAG 3 cut(s) 44, 102, 287
DpnI GATC 2 cut(s) 245, 261
DpnII GATC 2 cut(s) 243, 259
EcoRII CCWGG 1 cut(s) 91
FaiI YATR 9 cut(s) 50, 52, 146, 155, 168, 170, 188, 278, 280
Fnu4HI GCNGC 1 cut(s) 122
Fsp4HI GCNGC 1 cut(s) 122
FspBI CTAG 2 cut(s) 194, 249
GluI GCNGC 1 cut(s) 122
HaeIII GGCC 1 cut(s) 270
HapII CCGG 1 cut(s) 299
HinfI GANTC 1 cut(s) 211
HpaII CCGG 1 cut(s) 299
Hpy188I TCNGA 1 cut(s) 232
Hpy188III TCNNGA 3 cut(s) 140, 215, 241
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4IV ACGT 1 cut(s) 219
HpyCH4V TGCA 1 cut(s) 186
HpyF3I CTNAG 3 cut(s) 44, 102, 287
HpySE526I ACGT 1 cut(s) 219
Kzo9I GATC 2 cut(s) 243, 259
LpnPI CCDG 5 cut(s) 78, 105, 138, 219, 252
Lsp1109I GCAGC 1 cut(s) 133
LweI GCATC 1 cut(s) 223
MaeI CTAG 2 cut(s) 194, 249
MaeII ACGT 1 cut(s) 219
MalI GATC 2 cut(s) 245, 261
MboI GATC 2 cut(s) 243, 259
MluCI AATT 3 cut(s) 70, 189, 273
MnlI CCTC 1 cut(s) 109
MseI TTAA 2 cut(s) 74, 98
MspI CCGG 1 cut(s) 299
MspR9I CCNGG 2 cut(s) 93, 300
MvaI CCWGG 1 cut(s) 93
NciI CCSGG 1 cut(s) 300
NdeII GATC 2 cut(s) 243, 259
PfeI GAWTC 1 cut(s) 211
PkrI GCNGC 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 91
PspGI CCWGG 1 cut(s) 91
PspPI GGNCC 1 cut(s) 269
SaqAI TTAA 2 cut(s) 74, 98
SatI GCNGC 1 cut(s) 122
Sau3AI GATC 2 cut(s) 243, 259
Sau96I GGNCC 1 cut(s) 269
ScrFI CCNGG 2 cut(s) 93, 300
SetI ASST 3 cut(s) 108, 222, 295
SfaNI GCATC 1 cut(s) 223
SfcI CTRYAG 2 cut(s) 111, 264
Sse9I AATT 3 cut(s) 70, 189, 273
SspMI CTAG 2 cut(s) 194, 249
StyD4I CCNGG 2 cut(s) 91, 298
TaaI ACNGT 1 cut(s) 20
TaiI ACGT 1 cut(s) 222
TasI AATT 3 cut(s) 70, 189, 273
TfiI GAWTC 1 cut(s) 211
Tru1I TTAA 2 cut(s) 74, 98
Tru9I TTAA 2 cut(s) 74, 98
TseI GCWGC 1 cut(s) 121
TspDTI ATGAA 1 cut(s) 29
XspI CTAG 2 cut(s) 194, 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.