Rroxscaffold_2G00102040

WPP domain-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
24032962 .. 24036068
3107 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00102040.1

Sequence Viewer

Length: 192 bp
ATGTTGAGTTCTGAAAACATAGGACAAACTTTTTCGAATTCCTTGGAAGCACAGATATTGAGTTTGAAACAGCATGTGAAACTTATGGAAGGAAACTTGGATGAGACTAGGGCTAGGCTTGAGGTGAAGGAGTCCAAGGTTGCTGAAATGGAAGATATTGGTAACGTTAGCAACTCTTCTAAAGAAGAATGA

Protein Analysis

63

Amino Acids

7.02

Weight (kDa)

4.77

Isoelectric Point (pI)

38.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 165
AcsI RAATTY 1 cut(s) 37
AgsI TTSAA 1 cut(s) 67
Alw26I GTCTC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 136
AsuII TTCGAA 1 cut(s) 35
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 2 cut(s) 108, 114
Bpu14I TTCGAA 1 cut(s) 35
BpuEI CTTGAG 1 cut(s) 140
BsaJI CCNNGG 2 cut(s) 42, 135
BseDI CCNNGG 2 cut(s) 42, 135
BseGI GGATG 1 cut(s) 106
BsmAI GTCTC 1 cut(s) 98
Bsp119I TTCGAA 1 cut(s) 35
BspT104I TTCGAA 1 cut(s) 35
BssECI CCNNGG 2 cut(s) 42, 135
BssT1I CCWWGG 2 cut(s) 42, 135
Bst6I CTCTTC 1 cut(s) 181
BstBI TTCGAA 1 cut(s) 35
BstF5I GGATG 1 cut(s) 106
BstMAI GTCTC 1 cut(s) 98
BstNSI RCATGY 1 cut(s) 77
BtsCI GGATG 1 cut(s) 106
CviAII CATG 1 cut(s) 74
CviJI RGCY 2 cut(s) 113, 118
CviKI_1 RGCY 2 cut(s) 113, 118
Eam1104I CTCTTC 1 cut(s) 181
EarI CTCTTC 1 cut(s) 181
Eco130I CCWWGG 2 cut(s) 42, 135
EcoRI GAATTC 1 cut(s) 37
EcoT14I CCWWGG 2 cut(s) 42, 135
ErhI CCWWGG 2 cut(s) 42, 135
FaeI CATG 1 cut(s) 77
FaiI YATR 3 cut(s) 20, 75, 86
FatI CATG 1 cut(s) 73
FokI GGATG 1 cut(s) 113
FspBI CTAG 2 cut(s) 108, 114
Hin1II CATG 1 cut(s) 77
HinfI GANTC 1 cut(s) 131
HphI GGTGA 1 cut(s) 136
Hpy188I TCNGA 1 cut(s) 13
HpyAV CCTTC 2 cut(s) 83, 121
HpyCH4IV ACGT 1 cut(s) 165
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 1 cut(s) 77
MaeI CTAG 2 cut(s) 108, 114
MaeII ACGT 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 161
MboII GAAGA 2 cut(s) 164, 168
MluCI AATT 1 cut(s) 37
MlyI GAGTC 1 cut(s) 140
MnlI CCTC 1 cut(s) 115
NlaIII CATG 1 cut(s) 77
NspI RCATGY 1 cut(s) 77
NspV TTCGAA 1 cut(s) 35
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
Psp1406I AACGTT 1 cut(s) 165
SchI GAGTC 1 cut(s) 140
SetI ASST 3 cut(s) 126, 141, 168
SfuI TTCGAA 1 cut(s) 35
SgeI CNNG 7 cut(s) 55, 86, 109, 120, 126, 131, 148
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 1 cut(s) 37
SspMI CTAG 2 cut(s) 108, 114
StyI CCWWGG 2 cut(s) 42, 135
TaiI ACGT 1 cut(s) 168
TaqI TCGA 1 cut(s) 35
TasI AATT 1 cut(s) 37
XapI RAATTY 1 cut(s) 37
XceI RCATGY 1 cut(s) 77
XspI CTAG 2 cut(s) 108, 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.