Rroxscaffold_2G00110150

At4g29660-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
34380552 .. 34389402
8851 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00110150.1

Sequence Viewer

Length: 213 bp
ATGCCTGTCTTGATAGTGGCCATGATAACACCAACTTCTGCCTCTTCTTTTTCCAAAACGTATACCATCATTCTTCTTCCTCCATTTGCAAAGCAAAGAAAAATACGGGAAGATCATCCTGGCCATGCAGTCCCACTTATGAAGCCCAAGTTTTATGGAGGACCTTGGAAGGTAGAAAGAGGAGAGGTTCCGGCCACTCACCCACCCCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.76

Weight (kDa)

9.99

Isoelectric Point (pI)

48.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014011)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 62
AcoI YGGCCR 3 cut(s) 18, 121, 192
AjnI CCWGG 1 cut(s) 118
AoxI GGCC 3 cut(s) 18, 121, 192
AspS9I GGNCC 1 cut(s) 161
AsuHPI GGTGA 1 cut(s) 191
AvaII GGWCC 1 cut(s) 161
BalI TGGCCA 2 cut(s) 20, 123
BccI CCATC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 120
Bme1390I CCNGG 1 cut(s) 120
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 1 cut(s) 161
BmiI GGNNCC 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 164
BseGI GGATG 1 cut(s) 115
BseRI GAGGAG 1 cut(s) 195
BshFI GGCC 3 cut(s) 20, 123, 194
BsiSI CCGG 1 cut(s) 191
BslFI GGGAC 1 cut(s) 116
BsmFI GGGAC 1 cut(s) 116
BsnI GGCC 3 cut(s) 20, 123, 194
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 3 cut(s) 20, 123, 194
BspLI GGNNCC 1 cut(s) 189
BssECI CCNNGG 1 cut(s) 164
BssMI GATC 1 cut(s) 112
BssNAI GTATAC 1 cut(s) 63
BssT1I CCWWGG 1 cut(s) 164
Bst1107I GTATAC 1 cut(s) 63
Bst2UI CCWGG 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 49
BstF5I GGATG 1 cut(s) 115
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstNI CCWGG 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 118
BstZ17I GTATAC 1 cut(s) 63
BsuRI GGCC 3 cut(s) 20, 123, 194
BtsCI GGATG 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 161
CviAII CATG 2 cut(s) 22, 125
CviJI RGCY 4 cut(s) 20, 123, 145, 194
CviKI_1 RGCY 4 cut(s) 20, 123, 145, 194
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
EaeI YGGCCR 3 cut(s) 18, 121, 192
Eam1104I CTCTTC 1 cut(s) 49
EarI CTCTTC 1 cut(s) 49
Eco130I CCWWGG 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 161
EcoO109I RGGNCCY 1 cut(s) 161
EcoRII CCWGG 1 cut(s) 118
EcoT14I CCWWGG 1 cut(s) 164
ErhI CCWWGG 1 cut(s) 164
FaeI CATG 2 cut(s) 25, 128
FaiI YATR 6 cut(s) 23, 63, 126, 140, 156, 211
FaqI GGGAC 1 cut(s) 116
FatI CATG 2 cut(s) 21, 124
FblI GTMKAC 1 cut(s) 62
FokI GGATG 1 cut(s) 102
HaeIII GGCC 3 cut(s) 20, 123, 194
HapII CCGG 1 cut(s) 191
Hin1II CATG 2 cut(s) 25, 128
HpaII CCGG 1 cut(s) 191
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 63
Hpy188III TCNNGA 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 63
HpyAV CCTTC 1 cut(s) 163
HpyCH4IV ACGT 1 cut(s) 59
HpyCH4V TGCA 2 cut(s) 89, 128
HpySE526I ACGT 1 cut(s) 59
Hsp92II CATG 2 cut(s) 25, 128
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 4 cut(s) 18, 105, 132, 204
MaeII ACGT 1 cut(s) 59
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 4 cut(s) 36, 65, 68, 122
MlsI TGGCCA 2 cut(s) 20, 123
MluNI TGGCCA 2 cut(s) 20, 123
MnlI CCTC 5 cut(s) 52, 90, 152, 173, 178
Mox20I TGGCCA 2 cut(s) 20, 123
MscI TGGCCA 2 cut(s) 20, 123
Msp20I TGGCCA 2 cut(s) 20, 123
MspI CCGG 1 cut(s) 191
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
NdeII GATC 1 cut(s) 112
NlaIII CATG 2 cut(s) 25, 128
NlaIV GGNNCC 1 cut(s) 189
PpuMI RGGWCCY 1 cut(s) 161
Psp5II RGGWCCY 1 cut(s) 161
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 161
PspPPI RGGWCCY 1 cut(s) 161
Sau3AI GATC 1 cut(s) 112
Sau96I GGNCC 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 120
SetI ASST 4 cut(s) 62, 166, 174, 189
SinI GGWCC 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 118
StyI CCWWGG 1 cut(s) 164
TaiI ACGT 1 cut(s) 62
TspDTI ATGAA 1 cut(s) 155
VpaK11BI GGWCC 1 cut(s) 161
XmiI GTMKAC 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.