Rroxscaffold_2G00118390

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0004081
Physical Location & Seq
Reverse (-)
49854469 .. 49854813
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00118390.1

Sequence Viewer

Length: 345 bp
ATGGGTTTCGGCGATTCCGGACATAGGGAGCGAGGATTGGGCAGGCCGGGGCCGTTGATTCGGGTTGAGTCGGATGTGGTTAATATGAGAGCTGATGTGGGTGTGAGTGGTAAGGAGGATTTGGGGCCGTTGGTGAGGGATTCTAGGGATGCGGAGAGTAGAGGCTTCTCAAGGCGTTCAACATCTAGAAATAGCAATTCGTCACTCTTTCTTGTTCGCCTTGGACCGGTCCTCCTTGTTCATGATGCGACTCTTCTTTTGCCGGTGCATTTGTCAAAGCAACACTTGCTTTGGTATGGCTATGACAGAAGGCTGGCTTGCACATATTTCAAGAGCATTAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

12.68

Weight (kDa)

9.99

Isoelectric Point (pI)

53.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 17
AciI CCGC 1 cut(s) 152
AfiI CCNNNNNNNGG 2 cut(s) 24, 226
AgeI ACCGGT 1 cut(s) 226
AgsI TTSAA 2 cut(s) 180, 331
AluBI AGCT 2 cut(s) 92, 342
AluI AGCT 2 cut(s) 92, 342
Aor13HI TCCGGA 1 cut(s) 17
AoxI GGCC 3 cut(s) 44, 50, 125
ArsI GACNNNNNNTTYG 2 cut(s) 241, 273
AsiGI ACCGGT 1 cut(s) 226
AspS9I GGNCC 4 cut(s) 50, 125, 224, 229
AsuC2I CCSGG 1 cut(s) 48
AsuHPI GGTGA 1 cut(s) 145
AvaII GGWCC 2 cut(s) 224, 229
BceAI ACGGC 2 cut(s) 37, 112
BcnI CCSGG 1 cut(s) 48
BfaI CTAG 2 cut(s) 144, 186
Bme1390I CCNGG 1 cut(s) 48
Bme18I GGWCC 2 cut(s) 224, 229
BmgT120I GGNCC 4 cut(s) 50, 125, 224, 229
BmiI GGNNCC 2 cut(s) 51, 126
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 2 cut(s) 139, 235
BpuEI CTTGAG 1 cut(s) 154
BpuMI CCSGG 1 cut(s) 48
BsaJI CCNNGG 2 cut(s) 47, 220
BsaWI WCCGGW 2 cut(s) 17, 226
BsaXI ACNNNNNCTCC 2 cut(s) 216, 246
Bsc4I CCNNNNNNNGG 2 cut(s) 24, 226
Bse118I RCCGGY 2 cut(s) 226, 262
BseAI TCCGGA 1 cut(s) 17
BseDI CCNNGG 2 cut(s) 47, 220
BseGI GGATG 2 cut(s) 79, 154
BseLI CCNNNNNNNGG 2 cut(s) 24, 226
BshFI GGCC 3 cut(s) 46, 52, 127
BshTI ACCGGT 1 cut(s) 226
BsiSI CCGG 4 cut(s) 18, 47, 227, 263
BslI CCNNNNNNNGG 2 cut(s) 24, 226
BsnI GGCC 3 cut(s) 46, 52, 127
Bsp13I TCCGGA 1 cut(s) 17
BspACI CCGC 1 cut(s) 152
BspANI GGCC 3 cut(s) 46, 52, 127
BspEI TCCGGA 1 cut(s) 17
BspHI TCATGA 1 cut(s) 241
BspLI GGNNCC 2 cut(s) 51, 126
BsrFI RCCGGY 2 cut(s) 226, 262
BssAI RCCGGY 2 cut(s) 226, 262
BssECI CCNNGG 2 cut(s) 47, 220
BssT1I CCWWGG 1 cut(s) 220
Bst6I CTCTTC 1 cut(s) 258
BstAPI GCANNNNNTGC 1 cut(s) 286
BstC8I GCNNGC 3 cut(s) 44, 315, 319
BstF5I GGATG 2 cut(s) 79, 154
BstMWI GCNNNNNNNGC 1 cut(s) 286
BstSCI CCNGG 1 cut(s) 46
BsuRI GGCC 3 cut(s) 46, 52, 127
BtsCI GGATG 2 cut(s) 79, 154
Cac8I GCNNGC 3 cut(s) 44, 315, 319
CciI TCATGA 1 cut(s) 241
Cfr10I RCCGGY 2 cut(s) 226, 262
Cfr13I GGNCC 4 cut(s) 50, 125, 224, 229
CspAI ACCGGT 1 cut(s) 226
CviAII CATG 1 cut(s) 242
CviJI RGCY 9 cut(s) 46, 52, 92, 127, 165, 300, 313, 317, 342
CviKI_1 RGCY 9 cut(s) 46, 52, 92, 127, 165, 300, 313, 317, 342
Eam1104I CTCTTC 1 cut(s) 258
EarI CTCTTC 1 cut(s) 258
Eco130I CCWWGG 1 cut(s) 220
Eco47I GGWCC 2 cut(s) 224, 229
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 1 cut(s) 245
FaiI YATR 6 cut(s) 24, 86, 243, 297, 303, 325
FalI AAGNNNNNCTT 4 cut(s) 269, 301, 301, 333
FatI CATG 1 cut(s) 241
FokI GGATG 2 cut(s) 86, 161
FspBI CTAG 2 cut(s) 144, 186
HaeIII GGCC 3 cut(s) 46, 52, 127
HapII CCGG 4 cut(s) 18, 47, 227, 263
Hin1II CATG 1 cut(s) 245
HinfI GANTC 5 cut(s) 14, 58, 68, 140, 250
HpaII CCGG 4 cut(s) 18, 47, 227, 263
HphI GGTGA 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 4 cut(s) 18, 186, 242, 331
HpyAV CCTTC 1 cut(s) 303
HpyCH4V TGCA 2 cut(s) 268, 321
HpyF10VI GCNNNNNNNGC 1 cut(s) 286
Hsp92II CATG 1 cut(s) 245
Kpn2I TCCGGA 1 cut(s) 17
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 6 cut(s) 28, 31, 60, 240, 276, 299
LweI GCATC 2 cut(s) 139, 235
MaeI CTAG 2 cut(s) 144, 186
MaeIII GTNAC 1 cut(s) 201
MboII GAAGA 1 cut(s) 245
MluCI AATT 1 cut(s) 196
MlyI GAGTC 2 cut(s) 77, 244
MmeI TCCRAC 1 cut(s) 51
MnlI CCTC 5 cut(s) 26, 109, 129, 155, 242
MroI TCCGGA 1 cut(s) 17
MseI TTAA 1 cut(s) 81
MspI CCGG 4 cut(s) 18, 47, 227, 263
MspR9I CCNGG 1 cut(s) 48
MwoI GCNNNNNNNGC 1 cut(s) 286
NciI CCSGG 1 cut(s) 48
NlaIII CATG 1 cut(s) 245
NlaIV GGNNCC 2 cut(s) 51, 126
NmuCI GTSAC 1 cut(s) 201
PagI TCATGA 1 cut(s) 241
PfeI GAWTC 3 cut(s) 14, 58, 140
PinAI ACCGGT 1 cut(s) 226
PleI GAGTC 2 cut(s) 76, 244
PpsI GAGTC 2 cut(s) 76, 244
PspN4I GGNNCC 2 cut(s) 51, 126
PspPI GGNCC 4 cut(s) 50, 125, 224, 229
SaqAI TTAA 1 cut(s) 81
Sau96I GGNCC 4 cut(s) 50, 125, 224, 229
SchI GAGTC 2 cut(s) 77, 244
ScrFI CCNGG 1 cut(s) 48
SetI ASST 2 cut(s) 94, 344
SfaNI GCATC 2 cut(s) 139, 235
SinI GGWCC 2 cut(s) 224, 229
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
Sse9I AATT 1 cut(s) 196
SsiI CCGC 1 cut(s) 152
SspMI CTAG 2 cut(s) 144, 186
StyD4I CCNGG 1 cut(s) 46
StyI CCWWGG 1 cut(s) 220
TasI AATT 1 cut(s) 196
TfiI GAWTC 3 cut(s) 14, 58, 140
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseFI GTSAC 1 cut(s) 201
Tsp45I GTSAC 1 cut(s) 201
TspDTI ATGAA 1 cut(s) 230
VpaK11BI GGWCC 2 cut(s) 224, 229
XbaI TCTAGA 1 cut(s) 185
XspI CTAG 2 cut(s) 144, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.