Rroxscaffold_2G00139890

Belongs to the Casparian strip membrane proteins (CASP) family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
78174875 .. 78177106
2232 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00139890.1

Sequence Viewer

Length: 153 bp
ATGGACGAACTGCCAGGCTCGTTGGGCACCAGTGCCAGCTTGGCTCTGCGTTTCGGCCAGACCATATTCTCCACCGCATCTCTTCTCTTTATGTGTTTGGACGTCGAGTTCTACAGCTACACAGCTTTCTGGCTTTATCTTATCTCTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.62

Weight (kDa)

4.31

Isoelectric Point (pI)

26.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015024)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G50810 AT3G50810 AT3G50810 AT4G37235
fragaria_vesca FvH4_1g14420
malus_domestica MD02G1157700.v1.1 MD15G1272400.v1.1
prunus_persica Prupe.7G146000_v2.0.a1
pyrus_communis pycom15g23600
rosa_chinensis RchiOBHm_Chr2g0103141
rosa_roxburghii Rroxscaffold_2G00139890
rosa_rugosa Rorug02G0112100
rosa_samantha Rh2BG167600 Rh2CG167900 Rh2DG166500
rosa_wichuraiana Rw2G012610

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 105
AccB1I GGYRCC 1 cut(s) 26
AciI CCGC 1 cut(s) 75
AcoI YGGCCR 1 cut(s) 55
AcyI GRCGYC 1 cut(s) 102
AjnI CCWGG 1 cut(s) 13
AloI GAACNNNNNNTCC 2 cut(s) 92, 124
AluBI AGCT 3 cut(s) 39, 117, 125
AluI AGCT 3 cut(s) 39, 117, 125
AoxI GGCC 1 cut(s) 55
BaeGI GKGCMC 1 cut(s) 29
BanI GGYRCC 1 cut(s) 26
BciT130I CCWGG 1 cut(s) 15
BfaI CTAG 1 cut(s) 151
BfmI CTRYAG 1 cut(s) 112
BglI GCCNNNNNGGC 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 15
BmsI GCATC 1 cut(s) 86
BsaHI GRCGYC 1 cut(s) 102
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 15
BseNI ACTGG 1 cut(s) 30
BseSI GKGCMC 1 cut(s) 29
BshFI GGCC 1 cut(s) 57
BshNI GGYRCC 1 cut(s) 26
BsnI GGCC 1 cut(s) 57
Bsp1286I GDGCHC 1 cut(s) 29
BspACI CCGC 1 cut(s) 75
BspANI GGCC 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 28
BspT107I GGYRCC 1 cut(s) 26
BsrI ACTGG 1 cut(s) 30
BssNI GRCGYC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 15
Bst6I CTCTTC 1 cut(s) 87
BstACI GRCGYC 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 37
BstMWI GCNNNNNNNGC 2 cut(s) 24, 41
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 1 cut(s) 112
BstSLI GKGCMC 1 cut(s) 29
BsuRI GGCC 1 cut(s) 57
BtsIMutI CAGTG 1 cut(s) 37
Cac8I GCNNGC 1 cut(s) 37
CviJI RGCY 7 cut(s) 18, 39, 44, 57, 117, 125, 133
CviKI_1 RGCY 7 cut(s) 18, 39, 44, 57, 117, 125, 133
EaeI YGGCCR 1 cut(s) 55
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
EcoRII CCWGG 1 cut(s) 13
FaiI YATR 2 cut(s) 65, 92
FspBI CTAG 1 cut(s) 151
HaeIII GGCC 1 cut(s) 57
Hin1I GRCGYC 1 cut(s) 102
Hpy99I CGWCG 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 102
HpyF10VI GCNNNNNNNGC 2 cut(s) 24, 41
HpySE526I ACGT 1 cut(s) 102
Hsp92I GRCGYC 1 cut(s) 102
LpnPI CCDG 5 cut(s) 27, 43, 49, 71, 115
LweI GCATC 1 cut(s) 86
MaeI CTAG 1 cut(s) 151
MaeII ACGT 1 cut(s) 102
MboII GAAGA 1 cut(s) 74
MhlI GDGCHC 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
MwoI GCNNNNNNNGC 2 cut(s) 24, 41
NlaIV GGNNCC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 15
SduI GDGCHC 1 cut(s) 29
SetI ASST 4 cut(s) 41, 105, 119, 127
SfaNI GCATC 1 cut(s) 86
SfcI CTRYAG 1 cut(s) 112
SgeI CNNG 9 cut(s) 26, 27, 31, 42, 48, 52, 70, 118, 142
SsiI CCGC 1 cut(s) 75
SspMI CTAG 1 cut(s) 151
StyD4I CCNGG 1 cut(s) 13
TaiI ACGT 1 cut(s) 105
TaqI TCGA 1 cut(s) 105
TscAI CASTG 1 cut(s) 37
TspRI CASTG 1 cut(s) 37
XcmI CCANNNNNNNNNTGG 1 cut(s) 37
XspI CTAG 1 cut(s) 151
ZraI GACGTC 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.