Rroxscaffold_3G00258090

amino acid transporter

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0008864
Physical Location & Seq
Forward (+)
52432059 .. 52432674
616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00258090.1

Sequence Viewer

Length: 531 bp
ATGGTTGTGGGGTTAATAATATTACCTACAATGTGGTTGAAAAACCTACGATTGCTTGCCTACGTCTCAATGTGTGGCTTTCTATCAGCCATTATCATCGTCGTCTCAATTGTTTGTGTTGGTATTGATGGAGTAGGGTTCTCCAAAAGAGGGAAGATATTTGATTTGACCGGAATTCCTACCTCTCTTAGTTTGTTTGCATTTTGTTATGGAGTTCATTCCGTTACTCCCATGGTATACTCTTCTATGAAACATAGAAATCATTTCTACAAGATTTTGTTCATCGTTTTTCCCCTCTGCACTGTGAACTACATTATCCTAGCTGTTCTTGGCTACTTAATGTTTGGCGATGATGTTCAATCTCAAGTGATAATGAACCTGCCTACAAGTAAAGTCATTTCAAAAATAGCAATATACACCACTTTAGCGATCCCCATCGTCAAGTATGCACTCCTAATGACACCTTTAGCAAATGCCATTGAGAACAGCTTGCCAAAAAATGGAATAACATGCTCATTTTCATGTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04721 ko04723 ko04727 ko05032 ko05033 map04721 map04723 map04727 map05032 map05033
Pfam Domains
Protein Families
Aa_trans

Protein Analysis

176

Amino Acids

19.31

Weight (kDa)

9.2

Isoelectric Point (pI)

22.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aa_trans PF01490 1 - 166 2e-27 Transmembrane amino acid transporter protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 387
AccB7I CCANNNNNTGG 1 cut(s) 500
AccI GTMKAC 1 cut(s) 237
AclWI GGATC 1 cut(s) 424
AcsI RAATTY 1 cut(s) 174
AfiI CCNNNNNNNGG 2 cut(s) 150, 500
AgsI TTSAA 3 cut(s) 40, 359, 402
AluBI AGCT 2 cut(s) 323, 489
AluI AGCT 2 cut(s) 323, 489
Alw26I GTCTC 2 cut(s) 70, 109
AlwI GGATC 1 cut(s) 424
ApoI RAATTY 1 cut(s) 174
BccI CCATC 2 cut(s) 122, 443
BcoDI GTCTC 2 cut(s) 70, 109
BfaI CTAG 1 cut(s) 320
BfuAI ACCTGC 1 cut(s) 387
BpuEI CTTGAG 1 cut(s) 348
BsaBI GATNNNNATC 1 cut(s) 434
BsaJI CCNNGG 1 cut(s) 231
BsaWI WCCGGW 1 cut(s) 170
Bsc4I CCNNNNNNNGG 2 cut(s) 150, 500
Bse8I GATNNNNATC 1 cut(s) 434
BseDI CCNNGG 1 cut(s) 231
BseJI GATNNNNATC 1 cut(s) 434
BseLI CCNNNNNNNGG 2 cut(s) 150, 500
BsgI GTGCAG 1 cut(s) 283
BsiSI CCGG 1 cut(s) 171
BslI CCNNNNNNNGG 2 cut(s) 150, 500
BsmAI GTCTC 2 cut(s) 70, 109
BsmBI CGTCTC 2 cut(s) 70, 109
Bsp143I GATC 1 cut(s) 429
Bsp19I CCATGG 1 cut(s) 231
BspMI ACCTGC 1 cut(s) 387
BspPI GGATC 1 cut(s) 424
BssECI CCNNGG 1 cut(s) 231
BssMI GATC 1 cut(s) 429
BssNAI GTATAC 1 cut(s) 238
BssT1I CCWWGG 1 cut(s) 231
Bst1107I GTATAC 1 cut(s) 238
Bst4CI ACNGT 1 cut(s) 304
Bst6I CTCTTC 1 cut(s) 247
BstC8I GCNNGC 2 cut(s) 57, 491
BstDEI CTNAG 1 cut(s) 188
BstDSI CCRYGG 1 cut(s) 231
BstKTI GATC 1 cut(s) 432
BstMAI GTCTC 2 cut(s) 70, 109
BstMBI GATC 1 cut(s) 429
BstNSI RCATGY 1 cut(s) 513
BstZ17I GTATAC 1 cut(s) 238
BtgI CCRYGG 1 cut(s) 231
BtgZI GCGATG 1 cut(s) 363
BtsIMutI CAGTG 1 cut(s) 300
BveI ACCTGC 1 cut(s) 387
Cac8I GCNNGC 2 cut(s) 57, 491
CviAII CATG 3 cut(s) 232, 510, 522
CviJI RGCY 5 cut(s) 78, 89, 323, 333, 489
CviKI_1 RGCY 5 cut(s) 78, 89, 323, 333, 489
DdeI CTNAG 1 cut(s) 188
DpnI GATC 1 cut(s) 431
DpnII GATC 1 cut(s) 429
Eam1104I CTCTTC 1 cut(s) 247
EarI CTCTTC 1 cut(s) 247
Eco130I CCWWGG 1 cut(s) 231
EcoRI GAATTC 1 cut(s) 174
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
Esp3I CGTCTC 2 cut(s) 70, 109
FaeI CATG 3 cut(s) 235, 513, 525
FatI CATG 3 cut(s) 231, 509, 521
FblI GTMKAC 1 cut(s) 237
FspBI CTAG 1 cut(s) 320
HapII CCGG 1 cut(s) 171
Hin1II CATG 3 cut(s) 235, 513, 525
HpaII CCGG 1 cut(s) 171
Hpy166II GTNNAC 2 cut(s) 238, 307
Hpy8I GTNNAC 2 cut(s) 238, 307
Hpy99I CGWCG 1 cut(s) 104
HpyCH4III ACNGT 1 cut(s) 304
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 3 cut(s) 200, 300, 449
HpyF3I CTNAG 1 cut(s) 188
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 3 cut(s) 235, 513, 525
Kzo9I GATC 1 cut(s) 429
LpnPI CCDG 2 cut(s) 184, 392
MaeI CTAG 1 cut(s) 320
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 223
MalI GATC 1 cut(s) 431
MboI GATC 1 cut(s) 429
MboII GAAGA 2 cut(s) 166, 234
MfeI CAATTG 1 cut(s) 108
MluCI AATT 2 cut(s) 108, 174
MnlI CCTC 3 cut(s) 143, 193, 305
MseI TTAA 2 cut(s) 14, 338
MslI CAYNNNNRTG 1 cut(s) 520
MspI CCGG 1 cut(s) 171
MunI CAATTG 1 cut(s) 108
NcoI CCATGG 1 cut(s) 231
NdeII GATC 1 cut(s) 429
NlaIII CATG 3 cut(s) 235, 513, 525
NspI RCATGY 1 cut(s) 513
PflMI CCANNNNNTGG 1 cut(s) 500
RseI CAYNNNNRTG 1 cut(s) 520
SaqAI TTAA 2 cut(s) 14, 338
Sau3AI GATC 1 cut(s) 429
SetI ASST 8 cut(s) 28, 48, 66, 185, 325, 381, 466, 491
SmiMI CAYNNNNRTG 1 cut(s) 520
SmlI CTYRAG 1 cut(s) 363
SmoI CTYRAG 1 cut(s) 363
Sse9I AATT 2 cut(s) 108, 174
SspI AATATT 1 cut(s) 21
SspMI CTAG 1 cut(s) 320
StyI CCWWGG 1 cut(s) 231
TaaI ACNGT 1 cut(s) 304
TaiI ACGT 1 cut(s) 66
TasI AATT 2 cut(s) 108, 174
Tru1I TTAA 2 cut(s) 14, 338
Tru9I TTAA 2 cut(s) 14, 338
TscAI CASTG 1 cut(s) 307
TspDTI ATGAA 6 cut(s) 206, 263, 271, 389, 510, 516
TspGWI ACGGA 1 cut(s) 211
TspRI CASTG 1 cut(s) 307
Van91I CCANNNNNTGG 1 cut(s) 500
XapI RAATTY 1 cut(s) 174
XceI RCATGY 1 cut(s) 513
XmiI GTMKAC 1 cut(s) 237
XspI CTAG 1 cut(s) 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.