Rroxscaffold_4G00308860

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
30487612 .. 30487971
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00308860.1

Sequence Viewer

Length: 267 bp
ATGGCTGGAGTTTTGGACGAACCTCCAAGCATGGAAACCAATCTTATTTCAATTTCGGAAAAACTTCAAGAGACTTATTTAGGGGAAGATGAAGACAAAGATAGAGTAGAAGATGAAGAGGAAGAAGAAGATGAAGGAGAACCCGAAGACAATGTGGAACAACAAGGAGATAAAGAAATCCTTGGAGAGGAGAACGGAGGCAACGGAGGAATTGTGGAAAATAGAGAGAAGCAAGGCAGAATCGGAAATCATTTCAAGAAGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.89

Weight (kDa)

4.07

Isoelectric Point (pI)

54.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 187
AgsI TTSAA 3 cut(s) 51, 68, 256
Alw26I GTCTC 1 cut(s) 65
Asp700I GAANNNNTTC 1 cut(s) 63
BbsI GAAGAC 2 cut(s) 99, 153
BcoDI GTCTC 1 cut(s) 65
BpiI GAAGAC 2 cut(s) 99, 153
BpmI CTGGAG 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 181
BsaXI ACNNNNNCTCC 2 cut(s) 198, 228
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 181
BseLI CCNNNNNNNGG 1 cut(s) 187
BseRI GAGGAG 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 65
BssECI CCNNGG 1 cut(s) 181
BssT1I CCWWGG 1 cut(s) 181
Bst6I CTCTTC 1 cut(s) 111
BstENI CCTNNNNNAGG 1 cut(s) 185
BstMAI GTCTC 1 cut(s) 65
BstV2I GAAGAC 2 cut(s) 99, 153
CviAII CATG 1 cut(s) 31
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
Eam1104I CTCTTC 1 cut(s) 111
EarI CTCTTC 1 cut(s) 111
Eco130I CCWWGG 1 cut(s) 181
EcoNI CCTNNNNNAGG 1 cut(s) 185
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 32, 265
FalI AAGNNNNNCTT 2 cut(s) 165, 197
FatI CATG 1 cut(s) 30
GsuI CTGGAG 1 cut(s) 27
Hin1II CATG 1 cut(s) 34
HinfI GANTC 1 cut(s) 240
Hpy188I TCNGA 2 cut(s) 58, 245
Hpy188III TCNNGA 2 cut(s) 68, 256
HpyAV CCTTC 1 cut(s) 128
Hsp92II CATG 1 cut(s) 34
MboII GAAGA 8 cut(s) 98, 104, 122, 128, 134, 137, 140, 158
MluCI AATT 2 cut(s) 51, 210
MnlI CCTC 5 cut(s) 33, 112, 181, 191, 200
MroXI GAANNNNTTC 1 cut(s) 63
NlaIII CATG 1 cut(s) 34
PdmI GAANNNNTTC 1 cut(s) 63
PfeI GAWTC 1 cut(s) 240
SetI ASST 1 cut(s) 25
SgeI CNNG 8 cut(s) 18, 39, 43, 80, 155, 176, 194, 245
Sse9I AATT 2 cut(s) 51, 210
StyI CCWWGG 1 cut(s) 181
TasI AATT 2 cut(s) 51, 210
TfiI GAWTC 1 cut(s) 240
TspDTI ATGAA 3 cut(s) 105, 129, 147
TspGWI ACGGA 2 cut(s) 210, 219
XagI CCTNNNNNAGG 1 cut(s) 185
XmnI GAANNNNTTC 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.