Rroxscaffold_5G00346330

PAR1 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0008412
Physical Location & Seq
Reverse (-)
17069343 .. 17069827
485 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00346330.1

Sequence Viewer

Length: 330 bp
ATGGCTTCAAATGTATGCTTCAAAACCCTTGCAGTCCTCGCTCTTTTTCTTGCCGTTTGCGTGCAAGGCACTCGAGGAGGAGTAACATGTGAAAATCTGGACCAAGAGAGATGCGCATTTGCGGTTTCATCATCAGGCAACCGATTTGTTCTTGAGAAGCATGTGAGGAGAAGTGGACAAGAAGCATACACATGCCGCACATCAGAAATTGAAGCAAACGATAAGTTGAAAGCTTGGACTGAGAGCGAGCTGTGCATCAAGTCTAGTGGCCTTGACCACAAATCTTACGGAATCTCATCGGATTTTCTCCTAGAGTCTGGTTTCACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PAR1

Protein Analysis

109

Amino Acids

11.92

Weight (kDa)

6.09

Isoelectric Point (pI)

36.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAR1 PF06521 28 - 109 1.1e-30 PAR1 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 115
AciI CCGC 2 cut(s) 122, 196
AflIII ACRYGT 1 cut(s) 86
AgsI TTSAA 4 cut(s) 9, 22, 212, 229
AluBI AGCT 2 cut(s) 233, 250
AluI AGCT 2 cut(s) 233, 250
Ama87I CYCGRG 1 cut(s) 72
AoxI GGCC 1 cut(s) 268
AspLEI GCGC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 100
AvaI CYCGRG 1 cut(s) 72
AvaII GGWCC 1 cut(s) 100
BceAI ACGGC 1 cut(s) 38
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BfaI CTAG 2 cut(s) 264, 311
BisI GCNGC 1 cut(s) 196
BlsI GCNGC 1 cut(s) 197
Bme18I GGWCC 1 cut(s) 100
BmeT110I CYCGRG 1 cut(s) 72
BmgT120I GGNCC 1 cut(s) 100
BmsI GCATC 2 cut(s) 101, 264
BpuEI CTTGAG 1 cut(s) 173
BseMII CTCAG 1 cut(s) 231
BseRI GAGGAG 3 cut(s) 90, 93, 181
BshFI GGCC 1 cut(s) 270
BsiHKCI CYCGRG 1 cut(s) 72
BsnI GGCC 1 cut(s) 270
BsoBI CYCGRG 1 cut(s) 72
BspACI CCGC 2 cut(s) 122, 196
BspANI GGCC 1 cut(s) 270
BspCNI CTCAG 1 cut(s) 232
BstC8I GCNNGC 2 cut(s) 62, 248
BstDEI CTNAG 1 cut(s) 240
BstHHI GCGC 1 cut(s) 116
BstMWI GCNNNNNNNGC 3 cut(s) 38, 66, 252
BstNSI RCATGY 3 cut(s) 90, 164, 195
BsuRI GGCC 1 cut(s) 270
Cac8I GCNNGC 2 cut(s) 62, 248
CfoI GCGC 1 cut(s) 116
Cfr13I GGNCC 1 cut(s) 100
CspCI CAANNNNNGTGG 2 cut(s) 247, 282
CviAII CATG 3 cut(s) 87, 161, 192
CviJI RGCY 4 cut(s) 5, 233, 250, 270
CviKI_1 RGCY 4 cut(s) 5, 233, 250, 270
DdeI CTNAG 1 cut(s) 240
Eco47I GGWCC 1 cut(s) 100
Eco88I CYCGRG 1 cut(s) 72
FaeI CATG 3 cut(s) 90, 164, 195
FaiI YATR 6 cut(s) 16, 88, 162, 187, 193, 328
FatI CATG 3 cut(s) 86, 160, 191
Fnu4HI GCNGC 1 cut(s) 196
Fsp4HI GCNGC 1 cut(s) 196
FspAI RTGCGCAY 1 cut(s) 115
FspBI CTAG 2 cut(s) 264, 311
FspI TGCGCA 1 cut(s) 115
GlaI GCGC 1 cut(s) 115
GluI GCNGC 1 cut(s) 196
HaeIII GGCC 1 cut(s) 270
HhaI GCGC 1 cut(s) 116
Hin1II CATG 3 cut(s) 90, 164, 195
Hin6I GCGC 1 cut(s) 114
HinP1I GCGC 1 cut(s) 114
HindIII AAGCTT 1 cut(s) 231
HinfI GANTC 2 cut(s) 291, 314
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 2 cut(s) 205, 301
Hpy188III TCNNGA 2 cut(s) 98, 152
Hpy8I GTNNAC 1 cut(s) 176
HpyCH4V TGCA 3 cut(s) 32, 64, 255
HpyF10VI GCNNNNNNNGC 3 cut(s) 38, 66, 252
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 3 cut(s) 90, 164, 195
HspAI GCGC 1 cut(s) 114
LpnPI CCDG 3 cut(s) 83, 120, 303
LweI GCATC 2 cut(s) 101, 264
MaeI CTAG 2 cut(s) 264, 311
MaeIII GTNAC 1 cut(s) 82
MluCI AATT 1 cut(s) 207
MlyI GAGTC 1 cut(s) 323
MnlI CCTC 4 cut(s) 47, 68, 71, 159
MslI CAYNNNNRTG 1 cut(s) 190
MwoI GCNNNNNNNGC 3 cut(s) 38, 66, 252
NlaIII CATG 3 cut(s) 90, 164, 195
NsbI TGCGCA 1 cut(s) 115
NspI RCATGY 3 cut(s) 90, 164, 195
PaeR7I CTCGAG 1 cut(s) 72
PciI ACATGT 1 cut(s) 86
PfeI GAWTC 1 cut(s) 291
PkrI GCNGC 1 cut(s) 197
PleI GAGTC 1 cut(s) 322
PpsI GAGTC 1 cut(s) 322
PscI ACATGT 1 cut(s) 86
PspPI GGNCC 1 cut(s) 100
PspXI VCTCGAGB 1 cut(s) 72
RseI CAYNNNNRTG 1 cut(s) 190
SatI GCNGC 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 100
SchI GAGTC 1 cut(s) 323
SetI ASST 2 cut(s) 235, 252
SfaNI GCATC 2 cut(s) 101, 264
Sfr274I CTCGAG 1 cut(s) 72
SinI GGWCC 1 cut(s) 100
SlaI CTCGAG 1 cut(s) 72
SmiMI CAYNNNNRTG 1 cut(s) 190
SmlI CTYRAG 2 cut(s) 72, 152
SmoI CTYRAG 2 cut(s) 72, 152
Sse9I AATT 1 cut(s) 207
SsiI CCGC 2 cut(s) 122, 196
SspMI CTAG 2 cut(s) 264, 311
TaqI TCGA 1 cut(s) 73
TasI AATT 1 cut(s) 207
TauI GCSGC 1 cut(s) 198
TfiI GAWTC 1 cut(s) 291
TspDTI ATGAA 1 cut(s) 117
TspGWI ACGGA 1 cut(s) 303
VpaK11BI GGWCC 1 cut(s) 100
XceI RCATGY 3 cut(s) 90, 164, 195
XhoI CTCGAG 1 cut(s) 72
XspI CTAG 2 cut(s) 264, 311
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.