Rw1G036940

PAR1 protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
64712006 .. 64713966
1961 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G036940.1

Sequence Viewer

Length: 621 bp
ATGGCTTCTAACTTCTGCTTCACGACCCTTGCAATCCTCGCTCTTGCTCTTGCTGTTTGCGTGCAAGGCACTCTAGGGGGAGTAACATGTGAGAATCTAGACGAAAGCACTTGTGCGTTCGCAGTGTCATCATCGGCCAAACGCTGTGTGCTTGAGAAGCAAGTAAAGAGGAGCGGAGAGGAAGCATACACTTGCCGCACATCAGAGATTGAAGCAGATAAACTGAAGGACTGGATCGAGAGCGAGCAGTGCATTAAATCTTGCGGCCTGGACCGCAAGTCCTATGGAATCTCATCCGACTCTCTCCTCGAGTCTCGATTTGCACAGAAGCTTTGCTCTCCTCAGTGCTACGGCAGCTGCCCCAACATTGTTGATCTTTACTTCAACCTCGCAGCTGGTGAAGGGGTGTTCCTTCCAAAATTATGTGAAGCACAAGGAGCAAATGCTCGTAGGGATTTGTCCGAGTTGCGAAGCTCTGGATATGTTGCGCCAGGACCAGTAAAATCGGCTAACTTGGTAGCAGAGGCACCAGTAAACTACGTGAACTTGGAAGCTGAACACTACGTTGCTCCAGCACAGACACCATGTGCCGATGCTCCAGCACTGACACCAGGTTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

206

Amino Acids

21.98

Weight (kDa)

4.91

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAR1 PF06521 28 - 173 1.3e-73 PAR1 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 526
AccBSI CCGCTC 1 cut(s) 174
AciI CCGC 4 cut(s) 174, 196, 264, 274
AclWI GGATC 1 cut(s) 242
AcoI YGGCCR 1 cut(s) 135
AcuI CTGAAG 1 cut(s) 245
AdeI CACNNNGTG 1 cut(s) 587
AflIII ACRYGT 1 cut(s) 86
AgsI TTSAA 2 cut(s) 212, 385
AhdI GACNNNNNGTC 1 cut(s) 277
AjnI CCWGG 3 cut(s) 267, 490, 610
AluBI AGCT 5 cut(s) 331, 357, 395, 474, 554
AluI AGCT 5 cut(s) 331, 357, 395, 474, 554
Alw26I GTCTC 1 cut(s) 318
AlwI GGATC 1 cut(s) 242
Ama87I CYCGRG 1 cut(s) 308
AoxI GGCC 2 cut(s) 135, 265
ApeKI GCWGC 3 cut(s) 354, 357, 392
AspLEI GCGC 1 cut(s) 490
AspS9I GGNCC 2 cut(s) 271, 494
AsuHPI GGTGA 1 cut(s) 410
AvaI CYCGRG 1 cut(s) 308
AvaII GGWCC 2 cut(s) 271, 494
BanI GGYRCC 1 cut(s) 526
BbvI GCAGC 3 cut(s) 344, 366, 404
BceAI ACGGC 1 cut(s) 367
BciT130I CCWGG 3 cut(s) 269, 492, 612
BcoDI GTCTC 1 cut(s) 318
BfaI CTAG 2 cut(s) 74, 98
BisI GCNGC 5 cut(s) 196, 265, 355, 358, 393
BlsI GCNGC 5 cut(s) 197, 266, 356, 359, 394
Bme1390I CCNGG 3 cut(s) 269, 492, 612
Bme18I GGWCC 2 cut(s) 271, 494
BmeRI GACNNNNNGTC 1 cut(s) 277
BmeT110I CYCGRG 1 cut(s) 308
BmgT120I GGNCC 2 cut(s) 271, 494
BmiI GGNNCC 1 cut(s) 528
BmrFI CCNGG 3 cut(s) 269, 492, 612
BmsI GCATC 1 cut(s) 583
BpmI CTGGAG 2 cut(s) 555, 582
BpuEI CTTGAG 1 cut(s) 173
BsaAI YACGTR 1 cut(s) 541
Bse1I ACTGG 3 cut(s) 236, 497, 530
BseBI CCWGG 3 cut(s) 269, 492, 612
BseGI GGATG 1 cut(s) 293
BseMII CTCAG 1 cut(s) 356
BseNI ACTGG 3 cut(s) 236, 497, 530
BseRI GAGGAG 3 cut(s) 184, 296, 330
BseXI GCAGC 3 cut(s) 344, 366, 404
BshFI GGCC 2 cut(s) 137, 267
BshNI GGYRCC 1 cut(s) 526
BsiHKCI CYCGRG 1 cut(s) 308
BsmAI GTCTC 1 cut(s) 318
BsnI GGCC 2 cut(s) 137, 267
BsoBI CYCGRG 1 cut(s) 308
Bsp143I GATC 2 cut(s) 234, 373
BspACI CCGC 4 cut(s) 174, 196, 264, 274
BspANI GGCC 2 cut(s) 137, 267
BspCNI CTCAG 1 cut(s) 355
BspLI GGNNCC 1 cut(s) 528
BspPI GGATC 1 cut(s) 242
BspT107I GGYRCC 1 cut(s) 526
BsrBI CCGCTC 1 cut(s) 174
BsrI ACTGG 3 cut(s) 236, 497, 530
BssMI GATC 2 cut(s) 234, 373
Bst2UI CCWGG 3 cut(s) 269, 492, 612
BstBAI YACGTR 1 cut(s) 541
BstC8I GCNNGC 2 cut(s) 62, 245
BstDEI CTNAG 1 cut(s) 342
BstF5I GGATG 1 cut(s) 293
BstHHI GCGC 1 cut(s) 490
BstKTI GATC 2 cut(s) 237, 376
BstMAI GTCTC 1 cut(s) 318
BstMBI GATC 2 cut(s) 234, 373
BstMWI GCNNNNNNNGC 7 cut(s) 38, 66, 157, 249, 273, 354, 437
BstNI CCWGG 3 cut(s) 269, 492, 612
BstNSI RCATGY 1 cut(s) 90
BstSCI CCNGG 3 cut(s) 267, 490, 610
BstV1I GCAGC 3 cut(s) 344, 366, 404
BsuRI GGCC 2 cut(s) 137, 267
BtsCI GGATG 1 cut(s) 293
BtsI GCAGTG 2 cut(s) 129, 254
BtsIMutI CAGTG 4 cut(s) 129, 254, 350, 602
Cac8I GCNNGC 2 cut(s) 62, 245
CfoI GCGC 1 cut(s) 490
Cfr13I GGNCC 2 cut(s) 271, 494
CsiI ACCWGGT 1 cut(s) 610
CviAII CATG 2 cut(s) 87, 585
CviJI RGCY 9 cut(s) 5, 137, 267, 331, 357, 395, 474, 509, 554
CviKI_1 RGCY 9 cut(s) 5, 137, 267, 331, 357, 395, 474, 509, 554
DdeI CTNAG 1 cut(s) 342
DpnI GATC 2 cut(s) 236, 375
DpnII GATC 2 cut(s) 234, 373
DraIII CACNNNGTG 1 cut(s) 587
DriI GACNNNNNGTC 1 cut(s) 277
EaeI YGGCCR 1 cut(s) 135
Eam1105I GACNNNNNGTC 1 cut(s) 277
Eco47I GGWCC 2 cut(s) 271, 494
Eco57I CTGAAG 1 cut(s) 245
Eco88I CYCGRG 1 cut(s) 308
EcoRII CCWGG 3 cut(s) 267, 490, 610
FaeI CATG 2 cut(s) 90, 588
FaiI YATR 6 cut(s) 88, 187, 285, 424, 483, 586
FatI CATG 2 cut(s) 86, 584
Fnu4HI GCNGC 5 cut(s) 196, 265, 355, 358, 393
FokI GGATG 1 cut(s) 280
Fsp4HI GCNGC 5 cut(s) 196, 265, 355, 358, 393
FspBI CTAG 2 cut(s) 74, 98
GlaI GCGC 1 cut(s) 489
GluI GCNGC 5 cut(s) 196, 265, 355, 358, 393
GsuI CTGGAG 2 cut(s) 555, 582
HaeIII GGCC 2 cut(s) 137, 267
HhaI GCGC 1 cut(s) 490
Hin1II CATG 2 cut(s) 90, 588
Hin6I GCGC 1 cut(s) 488
HinP1I GCGC 1 cut(s) 488
HindIII AAGCTT 1 cut(s) 329
HinfI GANTC 4 cut(s) 94, 288, 299, 311
HphI GGTGA 1 cut(s) 410
Hpy166II GTNNAC 2 cut(s) 535, 544
Hpy188I TCNGA 3 cut(s) 205, 298, 463
Hpy188III TCNNGA 5 cut(s) 22, 98, 238, 315, 477
Hpy8I GTNNAC 2 cut(s) 535, 544
HpyAV CCTTC 3 cut(s) 220, 395, 422
HpyCH4IV ACGT 2 cut(s) 540, 564
HpyCH4V TGCA 4 cut(s) 32, 64, 252, 323
HpyF10VI GCNNNNNNNGC 7 cut(s) 38, 66, 157, 249, 273, 354, 437
HpyF3I CTNAG 1 cut(s) 342
HpySE526I ACGT 2 cut(s) 540, 564
Hsp92II CATG 2 cut(s) 90, 588
HspAI GCGC 1 cut(s) 488
Kzo9I GATC 2 cut(s) 234, 373
LmnI GCTCC 4 cut(s) 171, 437, 574, 601
Lsp1109I GCAGC 3 cut(s) 344, 366, 404
LweI GCATC 1 cut(s) 583
MabI ACCWGGT 1 cut(s) 610
MaeI CTAG 2 cut(s) 74, 98
MaeII ACGT 2 cut(s) 540, 564
MaeIII GTNAC 2 cut(s) 82, 614
MalI GATC 2 cut(s) 236, 375
MbiI CCGCTC 1 cut(s) 174
MboI GATC 2 cut(s) 234, 373
MluCI AATT 1 cut(s) 419
MlyI GAGTC 2 cut(s) 293, 320
MmeI TCCRAC 1 cut(s) 321
MnlI CCTC 7 cut(s) 47, 162, 172, 317, 351, 398, 517
MseI TTAA 1 cut(s) 255
MspA1I CMGCKG 2 cut(s) 357, 395
MspR9I CCNGG 3 cut(s) 269, 492, 612
MvaI CCWGG 3 cut(s) 269, 492, 612
MwoI GCNNNNNNNGC 7 cut(s) 38, 66, 157, 249, 273, 354, 437
NdeII GATC 2 cut(s) 234, 373
NlaIII CATG 2 cut(s) 90, 588
NlaIV GGNNCC 1 cut(s) 528
NspI RCATGY 1 cut(s) 90
PaeR7I CTCGAG 1 cut(s) 308
PciI ACATGT 1 cut(s) 86
PfeI GAWTC 2 cut(s) 94, 288
PkrI GCNGC 5 cut(s) 197, 266, 356, 359, 394
PleI GAGTC 2 cut(s) 293, 319
PpsI GAGTC 2 cut(s) 293, 319
Ppu21I YACGTR 1 cut(s) 541
PscI ACATGT 1 cut(s) 86
Psp6I CCWGG 3 cut(s) 267, 490, 610
PspGI CCWGG 3 cut(s) 267, 490, 610
PspN4I GGNNCC 1 cut(s) 528
PspPI GGNCC 2 cut(s) 271, 494
PspXI VCTCGAGB 1 cut(s) 308
PvuII CAGCTG 2 cut(s) 357, 395
SaqAI TTAA 1 cut(s) 255
SatI GCNGC 5 cut(s) 196, 265, 355, 358, 393
Sau3AI GATC 2 cut(s) 234, 373
Sau96I GGNCC 2 cut(s) 271, 494
SchI GAGTC 2 cut(s) 293, 320
ScrFI CCNGG 3 cut(s) 269, 492, 612
SetI ASST 9 cut(s) 333, 359, 390, 397, 476, 543, 556, 567, 616
SexAI ACCWGGT 1 cut(s) 610
SfaNI GCATC 1 cut(s) 583
Sfr274I CTCGAG 1 cut(s) 308
SinI GGWCC 2 cut(s) 271, 494
SlaI CTCGAG 1 cut(s) 308
SmlI CTYRAG 2 cut(s) 152, 308
SmoI CTYRAG 2 cut(s) 152, 308
Sse9I AATT 1 cut(s) 419
SsiI CCGC 4 cut(s) 174, 196, 264, 274
SspMI CTAG 2 cut(s) 74, 98
StyD4I CCNGG 3 cut(s) 267, 490, 610
TaiI ACGT 2 cut(s) 543, 567
TaqI TCGA 3 cut(s) 237, 309, 316
TasI AATT 1 cut(s) 419
TauI GCSGC 2 cut(s) 198, 267
TfiI GAWTC 2 cut(s) 94, 288
Tru1I TTAA 1 cut(s) 255
Tru9I TTAA 1 cut(s) 255
TscAI CASTG 4 cut(s) 129, 254, 350, 609
TseI GCWGC 3 cut(s) 354, 357, 392
TspRI CASTG 4 cut(s) 129, 254, 350, 609
VpaK11BI GGWCC 2 cut(s) 271, 494
XbaI TCTAGA 1 cut(s) 97
XceI RCATGY 1 cut(s) 90
XhoI CTCGAG 1 cut(s) 308
XspI CTAG 2 cut(s) 74, 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.