Rroxscaffold_5G00349140

Belongs to the peptidase S10 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0004218
Physical Location & Seq
Reverse (-)
21841739 .. 21847897
6159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00349140.1

Sequence Viewer

Length: 315 bp
ATGCTGGCGTCCACGAAGAACTACAAGTCGAAAGGAGTCCAGAAAATGATCCTCTCGCTGATTTGGTTGACGGAGGTCCTCGATGCTCTTCGTTTTATGGCCTCATCTACGAAATTGGTAGCAAACATCATATTCTTAGATGCTCCCGCTGGTACCGTTTACTCCTACTCCACCACTTTCCACGGGTTAATCTCTAGTGACACCTTACATTCAACCCGTATTTATAAGTTTCTCCAGAAGTGGCTTACGACTCATCAAAAGTTCCTTGCAAATCCACTCTTTGTTGCTGGTGACGTTGACTACCGTAGCAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_S10

Protein Analysis

104

Amino Acids

11.72

Weight (kDa)

9.65

Isoelectric Point (pI)

35.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S10 PF00450 40 - 98 5.4e-14 Serine carboxypeptidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 225
Acc65I GGTACC 1 cut(s) 152
AccB1I GGYRCC 1 cut(s) 152
AciI CCGC 1 cut(s) 147
AclWI GGATC 1 cut(s) 43
AcyI GRCGYC 1 cut(s) 8
AfaI GTAC 1 cut(s) 154
AgsI TTSAA 1 cut(s) 213
AlwI GGATC 1 cut(s) 43
AoxI GGCC 1 cut(s) 99
Asp718I GGTACC 1 cut(s) 152
AspS9I GGNCC 1 cut(s) 76
AsuHPI GGTGA 1 cut(s) 302
AvaII GGWCC 1 cut(s) 76
BanI GGYRCC 1 cut(s) 152
BfaI CTAG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 1 cut(s) 76
BmiI GGNNCC 1 cut(s) 154
BmsI GCATC 2 cut(s) 73, 130
BoxI GACNNNNGTC 1 cut(s) 74
BpmI CTGGAG 1 cut(s) 218
BsaHI GRCGYC 1 cut(s) 8
BsaJI CCNNGG 1 cut(s) 181
BsaXI ACNNNNNCTCC 2 cut(s) 152, 182
BseDI CCNNGG 1 cut(s) 181
BshFI GGCC 1 cut(s) 101
BshNI GGYRCC 1 cut(s) 152
BsnI GGCC 1 cut(s) 101
Bsp143I GATC 1 cut(s) 48
BspACI CCGC 1 cut(s) 147
BspANI GGCC 1 cut(s) 101
BspLI GGNNCC 1 cut(s) 154
BspPI GGATC 1 cut(s) 43
BspQI GCTCTTC 1 cut(s) 93
BspT107I GGYRCC 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 181
BssMI GATC 1 cut(s) 48
BssNI GRCGYC 1 cut(s) 8
Bst4CI ACNGT 2 cut(s) 157, 305
Bst6I CTCTTC 1 cut(s) 93
BstACI GRCGYC 1 cut(s) 8
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 136
BstDSI CCRYGG 1 cut(s) 181
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstPAI GACNNNNGTC 1 cut(s) 74
BsuRI GGCC 1 cut(s) 101
BtgI CCRYGG 1 cut(s) 181
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 76
Csp6I GTAC 1 cut(s) 153
CviJI RGCY 2 cut(s) 101, 244
CviKI_1 RGCY 2 cut(s) 101, 244
CviQI GTAC 1 cut(s) 153
DdeI CTNAG 1 cut(s) 136
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
Eco47I GGWCC 1 cut(s) 76
EcoO109I RGGNCCY 1 cut(s) 76
FaiI YATR 3 cut(s) 98, 131, 225
FauI CCCGC 1 cut(s) 154
FspBI CTAG 1 cut(s) 195
GsuI CTGGAG 1 cut(s) 218
HaeIII GGCC 1 cut(s) 101
Hin1I GRCGYC 1 cut(s) 8
HincII GTYRAC 2 cut(s) 69, 298
HindII GTYRAC 2 cut(s) 69, 298
HinfI GANTC 2 cut(s) 36, 250
HphI GGTGA 1 cut(s) 302
Hpy166II GTNNAC 4 cut(s) 12, 69, 160, 298
Hpy188III TCNNGA 2 cut(s) 40, 235
Hpy8I GTNNAC 4 cut(s) 12, 69, 160, 298
HpyCH4III ACNGT 2 cut(s) 157, 305
HpyCH4IV ACGT 1 cut(s) 294
HpyCH4V TGCA 1 cut(s) 269
HpyF3I CTNAG 1 cut(s) 136
HpySE526I ACGT 1 cut(s) 294
Hsp92I GRCGYC 1 cut(s) 8
KpnI GGTACC 1 cut(s) 156
Kzo9I GATC 1 cut(s) 48
LguI GCTCTTC 1 cut(s) 93
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 4 cut(s) 53, 135, 248, 273
LweI GCATC 2 cut(s) 73, 130
MaeI CTAG 1 cut(s) 195
MaeII ACGT 1 cut(s) 294
MaeIII GTNAC 2 cut(s) 197, 290
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MboII GAAGA 2 cut(s) 28, 80
MluCI AATT 1 cut(s) 113
MlyI GAGTC 2 cut(s) 45, 244
MnlI CCTC 4 cut(s) 62, 67, 89, 112
MseI TTAA 2 cut(s) 188, 313
MspA1I CMGCKG 1 cut(s) 149
NdeII GATC 1 cut(s) 48
NlaIV GGNNCC 1 cut(s) 154
NmuCI GTSAC 2 cut(s) 197, 290
PciSI GCTCTTC 1 cut(s) 93
PleI GAGTC 2 cut(s) 44, 244
PpsI GAGTC 2 cut(s) 44, 244
PpuMI RGGWCCY 1 cut(s) 76
PshAI GACNNNNGTC 1 cut(s) 74
PsiI TTATAA 1 cut(s) 225
Psp5II RGGWCCY 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 154
PspPI GGNCC 1 cut(s) 76
PspPPI RGGWCCY 1 cut(s) 76
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
SapI GCTCTTC 1 cut(s) 93
SaqAI TTAA 2 cut(s) 188, 313
Sau3AI GATC 1 cut(s) 48
Sau96I GGNCC 1 cut(s) 76
SchI GAGTC 2 cut(s) 45, 244
SetI ASST 3 cut(s) 78, 206, 297
SfaNI GCATC 2 cut(s) 73, 130
SinI GGWCC 1 cut(s) 76
Sse9I AATT 1 cut(s) 113
SsiI CCGC 1 cut(s) 147
SspMI CTAG 1 cut(s) 195
TaaI ACNGT 2 cut(s) 157, 305
TaiI ACGT 1 cut(s) 297
TaqI TCGA 2 cut(s) 29, 81
TasI AATT 1 cut(s) 113
Tru1I TTAA 2 cut(s) 188, 313
Tru9I TTAA 2 cut(s) 188, 313
TseFI GTSAC 2 cut(s) 197, 290
Tsp45I GTSAC 2 cut(s) 197, 290
TspGWI ACGGA 1 cut(s) 86
VpaK11BI GGWCC 1 cut(s) 76
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.