Rroxscaffold_5G00359020

Gibberellin-regulated protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0017126
Physical Location & Seq
Forward (+)
39071893 .. 39072816
924 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00359020.1

Sequence Viewer

Length: 330 bp
ATGGCTAGGCTCTCATGGATTTCCATTGCTTTCTTTGTCATCCTTGCCTTCGCAATCAATACTTTGGCTCAATGGGATATCGATCAAAGTCCTGCTCCTGCTGTTCAAATTTTTCCTAAAGGCGGAGAAGGATCACTTAAACCCGAAGATTGCGCGGGAGCGTGTGATTTTCGGTGTTCAGCAACTTCACACAAGAAGCCATGTCTATTCTTTTGCAATATGTGTTGTCAAAAATGTCTGTGTGTCCCATCGGGCACATATGGACACAAAGAAGAATGTCCATGCTACAACAACTGGAAAACCAAGGAAGGAGGTCCCAAATGCCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GASA

Protein Analysis

109

Amino Acids

11.96

Weight (kDa)

7.97

Isoelectric Point (pI)

50.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GASA PF02704 50 - 109 1.6e-24 Gibberellin regulated protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017126)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G30810
fragaria_vesca FvH4_4g16460
malus_domestica MD04G1009200.v1.1 MD04G1009300.v1.1 MD13G1285300.v1.1
prunus_persica Prupe.1G008600_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0415191
rosa_roxburghii Rroxscaffold_5G00359010 Rroxscaffold_5G00359020
rosa_samantha Rh4BG191000 Rh4BG191200
rosa_wichuraiana Rw4G016400 Rw4G016410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 155
AciI CCGC 2 cut(s) 123, 155
AclWI GGATC 1 cut(s) 139
AcsI RAATTY 1 cut(s) 108
AfiI CCNNNNNNNGG 1 cut(s) 122
AgsI TTSAA 1 cut(s) 107
AlwI GGATC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 108
AspLEI GCGC 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 314
AvaII GGWCC 1 cut(s) 314
BaeGI GKGCMC 1 cut(s) 257
BccI CCATC 1 cut(s) 256
BfaI CTAG 1 cut(s) 6
Bme18I GGWCC 1 cut(s) 314
BmgT120I GGNCC 1 cut(s) 314
BmiI GGNNCC 1 cut(s) 316
Bsa29I ATCGAT 1 cut(s) 81
BsaBI GATNNNNATC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 303
Bsc4I CCNNNNNNNGG 1 cut(s) 122
Bse1I ACTGG 1 cut(s) 299
Bse3DI GCAATG 1 cut(s) 24
Bse8I GATNNNNATC 1 cut(s) 81
BseCI ATCGAT 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 303
BseGI GGATG 1 cut(s) 39
BseJI GATNNNNATC 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 122
BseMI GCAATG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 299
BseSI GKGCMC 1 cut(s) 257
Bsh1236I CGCG 1 cut(s) 155
BshVI ATCGAT 1 cut(s) 81
BslFI GGGAC 2 cut(s) 230, 300
BslI CCNNNNNNNGG 1 cut(s) 122
BsmFI GGGAC 2 cut(s) 230, 300
Bsp1286I GDGCHC 1 cut(s) 257
Bsp143I GATC 2 cut(s) 82, 131
BspACI CCGC 2 cut(s) 123, 155
BspDI ATCGAT 1 cut(s) 81
BspFNI CGCG 1 cut(s) 155
BspLI GGNNCC 1 cut(s) 316
BspPI GGATC 1 cut(s) 139
BsrDI GCAATG 1 cut(s) 24
BsrI ACTGG 1 cut(s) 299
BssECI CCNNGG 1 cut(s) 303
BssMI GATC 2 cut(s) 82, 131
BssT1I CCWWGG 1 cut(s) 303
BstF5I GGATG 1 cut(s) 39
BstFNI CGCG 1 cut(s) 155
BstHHI GCGC 1 cut(s) 155
BstKTI GATC 2 cut(s) 85, 134
BstMBI GATC 2 cut(s) 82, 131
BstSLI GKGCMC 1 cut(s) 257
BstUI CGCG 1 cut(s) 155
Bsu15I ATCGAT 1 cut(s) 81
BsuTUI ATCGAT 1 cut(s) 81
BtsCI GGATG 1 cut(s) 39
CfoI GCGC 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 314
ClaI ATCGAT 1 cut(s) 81
CviAII CATG 3 cut(s) 15, 201, 282
CviJI RGCY 4 cut(s) 5, 10, 68, 199
CviKI_1 RGCY 4 cut(s) 5, 10, 68, 199
DpnI GATC 2 cut(s) 84, 133
DpnII GATC 2 cut(s) 82, 131
EciI GGCGGA 1 cut(s) 138
Eco130I CCWWGG 1 cut(s) 303
Eco32I GATATC 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 314
EcoO109I RGGNCCY 1 cut(s) 314
EcoRV GATATC 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 303
ErhI CCWWGG 1 cut(s) 303
FaeI CATG 3 cut(s) 18, 204, 285
FaiI YATR 6 cut(s) 16, 202, 221, 259, 261, 283
FalI AAGNNNNNCTT 2 cut(s) 120, 152
FaqI GGGAC 2 cut(s) 230, 300
FatI CATG 3 cut(s) 14, 200, 281
FauI CCCGC 1 cut(s) 148
FauNDI CATATG 1 cut(s) 259
FokI GGATG 1 cut(s) 26
FspBI CTAG 1 cut(s) 6
GlaI GCGC 1 cut(s) 154
HhaI GCGC 1 cut(s) 155
Hin1II CATG 3 cut(s) 18, 204, 285
Hin6I GCGC 1 cut(s) 153
HinP1I GCGC 1 cut(s) 153
HpyAV CCTTC 3 cut(s) 58, 122, 302
HpyCH4V TGCA 1 cut(s) 216
Hsp92II CATG 3 cut(s) 18, 204, 285
HspAI GCGC 1 cut(s) 153
Kzo9I GATC 2 cut(s) 82, 131
LmnI GCTCC 2 cut(s) 100, 158
LpnPI CCDG 3 cut(s) 105, 111, 280
MaeI CTAG 1 cut(s) 6
MalI GATC 2 cut(s) 84, 133
MboI GATC 2 cut(s) 82, 131
MboII GAAGA 2 cut(s) 158, 284
MhlI GDGCHC 1 cut(s) 257
MluCI AATT 1 cut(s) 108
MnlI CCTC 1 cut(s) 305
MseI TTAA 1 cut(s) 138
MvnI CGCG 1 cut(s) 155
NdeI CATATG 1 cut(s) 259
NdeII GATC 2 cut(s) 82, 131
NlaIII CATG 3 cut(s) 18, 204, 285
NlaIV GGNNCC 1 cut(s) 316
PpuMI RGGWCCY 1 cut(s) 314
Psp5II RGGWCCY 1 cut(s) 314
PspN4I GGNNCC 1 cut(s) 316
PspPI GGNCC 1 cut(s) 314
PspPPI RGGWCCY 1 cut(s) 314
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 2 cut(s) 82, 131
Sau96I GGNCC 1 cut(s) 314
SduI GDGCHC 1 cut(s) 257
SetI ASST 1 cut(s) 316
SinI GGWCC 1 cut(s) 314
Sse9I AATT 1 cut(s) 108
SsiI CCGC 2 cut(s) 123, 155
SspMI CTAG 1 cut(s) 6
StyI CCWWGG 1 cut(s) 303
TaqI TCGA 1 cut(s) 81
TasI AATT 1 cut(s) 108
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
VpaK11BI GGWCC 1 cut(s) 314
XapI RAATTY 1 cut(s) 108
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.