Rw4G016410

Gibberellin-regulated protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Forward (+)
37468356 .. 37469247
892 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G016410.1

Sequence Viewer

Length: 279 bp
ATGGCTAGGCTCTCATGGATTTCCATTGCTTTCTTTGTCGTCCTTGCCTTCGCAATCAATACTTTGCAAGGCGGAGAAGGATCGCTTAAACCTGAAGAATGCGCGGGAGCGTGTGATTTTCGGTGTTCAGCAACTTCACACAAGAAGCCATGTCTGTTCTTTTGCAACATGTGTTGTCAAAAATGTCTCTGTGTCCCATCGGGCACATATGGACACAAAGAAGAATGTCCATGCTACAACAACTGGAAAACCCAGGAAGGAGGTCCCAAATGCCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.09

Weight (kDa)

7.97

Isoelectric Point (pI)

49.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GASA PF02704 33 - 92 1.6e-24 Gibberellin regulated protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017126)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 104
AciI CCGC 2 cut(s) 72, 104
AclWI GGATC 1 cut(s) 88
AcuI CTGAAG 1 cut(s) 114
AflIII ACRYGT 1 cut(s) 168
AjnI CCWGG 1 cut(s) 252
Alw26I GTCTC 1 cut(s) 191
AlwI GGATC 1 cut(s) 88
AspLEI GCGC 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 263
AvaII GGWCC 1 cut(s) 263
BaeGI GKGCMC 1 cut(s) 206
BccI CCATC 1 cut(s) 205
BciT130I CCWGG 1 cut(s) 254
BcoDI GTCTC 1 cut(s) 191
BfaI CTAG 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 254
Bme18I GGWCC 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 263
BmiI GGNNCC 1 cut(s) 265
BmrFI CCNGG 1 cut(s) 254
BsaJI CCNNGG 1 cut(s) 252
Bse1I ACTGG 1 cut(s) 248
Bse3DI GCAATG 1 cut(s) 24
BseBI CCWGG 1 cut(s) 254
BseDI CCNNGG 1 cut(s) 252
BseMI GCAATG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 248
BseSI GKGCMC 1 cut(s) 206
Bsh1236I CGCG 1 cut(s) 104
BslFI GGGAC 2 cut(s) 179, 249
BsmAI GTCTC 1 cut(s) 191
BsmFI GGGAC 2 cut(s) 179, 249
BsmI GAATGC 1 cut(s) 104
Bsp1286I GDGCHC 1 cut(s) 206
Bsp143I GATC 1 cut(s) 80
BspACI CCGC 2 cut(s) 72, 104
BspFNI CGCG 1 cut(s) 104
BspLI GGNNCC 1 cut(s) 265
BspPI GGATC 1 cut(s) 88
BsrDI GCAATG 1 cut(s) 24
BsrI ACTGG 1 cut(s) 248
BssECI CCNNGG 1 cut(s) 252
BssMI GATC 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 254
BstFNI CGCG 1 cut(s) 104
BstHHI GCGC 1 cut(s) 104
BstKTI GATC 1 cut(s) 83
BstMAI GTCTC 1 cut(s) 191
BstMBI GATC 1 cut(s) 80
BstNI CCWGG 1 cut(s) 254
BstNSI RCATGY 1 cut(s) 172
BstSCI CCNGG 1 cut(s) 252
BstSLI GKGCMC 1 cut(s) 206
BstUI CGCG 1 cut(s) 104
CfoI GCGC 1 cut(s) 104
Cfr13I GGNCC 1 cut(s) 263
CviAII CATG 4 cut(s) 15, 150, 169, 231
CviJI RGCY 3 cut(s) 5, 10, 148
CviKI_1 RGCY 3 cut(s) 5, 10, 148
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
EciI GGCGGA 1 cut(s) 87
Eco47I GGWCC 1 cut(s) 263
Eco57I CTGAAG 1 cut(s) 114
EcoO109I RGGNCCY 1 cut(s) 263
EcoRII CCWGG 1 cut(s) 252
FaeI CATG 4 cut(s) 18, 153, 172, 234
FaiI YATR 6 cut(s) 16, 151, 170, 208, 210, 232
FalI AAGNNNNNCTT 2 cut(s) 69, 101
FaqI GGGAC 2 cut(s) 179, 249
FatI CATG 4 cut(s) 14, 149, 168, 230
FauI CCCGC 1 cut(s) 97
FauNDI CATATG 1 cut(s) 208
FspBI CTAG 1 cut(s) 6
GlaI GCGC 1 cut(s) 103
HhaI GCGC 1 cut(s) 104
Hin1II CATG 4 cut(s) 18, 153, 172, 234
Hin6I GCGC 1 cut(s) 102
HinP1I GCGC 1 cut(s) 102
HpyAV CCTTC 3 cut(s) 58, 71, 251
HpyCH4V TGCA 2 cut(s) 67, 165
Hsp92II CATG 4 cut(s) 18, 153, 172, 234
HspAI GCGC 1 cut(s) 102
Kzo9I GATC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 4 cut(s) 105, 229, 239, 266
MaeI CTAG 1 cut(s) 6
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 2 cut(s) 107, 233
MhlI GDGCHC 1 cut(s) 206
MnlI CCTC 1 cut(s) 254
MseI TTAA 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 254
Mva1269I GAATGC 1 cut(s) 104
MvaI CCWGG 1 cut(s) 254
MvnI CGCG 1 cut(s) 104
NdeI CATATG 1 cut(s) 208
NdeII GATC 1 cut(s) 80
NlaIII CATG 4 cut(s) 18, 153, 172, 234
NlaIV GGNNCC 1 cut(s) 265
NspI RCATGY 1 cut(s) 172
PciI ACATGT 1 cut(s) 168
PctI GAATGC 1 cut(s) 104
PpuMI RGGWCCY 1 cut(s) 263
PscI ACATGT 1 cut(s) 168
Psp5II RGGWCCY 1 cut(s) 263
Psp6I CCWGG 1 cut(s) 252
PspGI CCWGG 1 cut(s) 252
PspN4I GGNNCC 1 cut(s) 265
PspPI GGNCC 1 cut(s) 263
PspPPI RGGWCCY 1 cut(s) 263
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 1 cut(s) 80
Sau96I GGNCC 1 cut(s) 263
ScrFI CCNGG 1 cut(s) 254
SduI GDGCHC 1 cut(s) 206
SetI ASST 2 cut(s) 94, 265
SinI GGWCC 1 cut(s) 263
SsiI CCGC 2 cut(s) 72, 104
SspMI CTAG 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 252
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 263
XceI RCATGY 1 cut(s) 172
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.