Rroxscaffold_5G00379210

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
59665945 .. 59668163
2219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00379210.1

Sequence Viewer

Length: 222 bp
ATGTTAAACAAAGGTTGGTTGTTTGAGTTCGTGTTTCTTTTTCTCGTTTGTTCCAGTTATCTTGATTATGGGATGGAGCCAATTGAAATTGAGTTGTTCCTAGAATCACTATTCTACTACCCTCCACTTCCAAAGCAGTTTAGATTTATGTATGGATTGGTTGTAACTCAGGAAAATTGGGACATTTGTATGCAGCAGCACCTACTCGACCTAGTACAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.88

Weight (kDa)

4.25

Isoelectric Point (pI)

59.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014519)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 216
AgsI TTSAA 1 cut(s) 86
ApeKI GCWGC 2 cut(s) 193, 196
BbvI GCAGC 2 cut(s) 205, 208
BccI CCATC 1 cut(s) 67
BfaI CTAG 2 cut(s) 101, 212
BisI GCNGC 2 cut(s) 194, 197
BlsI GCNGC 2 cut(s) 195, 198
BmiI GGNNCC 1 cut(s) 78
Bse1I ACTGG 1 cut(s) 54
BseGI GGATG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 182
BseNI ACTGG 1 cut(s) 54
BseXI GCAGC 2 cut(s) 205, 208
BslFI GGGAC 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 194
BspCNI CTCAG 1 cut(s) 181
BspLI GGNNCC 1 cut(s) 78
BsrI ACTGG 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 219
BstDEI CTNAG 1 cut(s) 168
BstF5I GGATG 1 cut(s) 78
BstV1I GCAGC 2 cut(s) 205, 208
BtsCI GGATG 1 cut(s) 78
Csp6I GTAC 1 cut(s) 215
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
CviQI GTAC 1 cut(s) 215
DdeI CTNAG 1 cut(s) 168
FaiI YATR 4 cut(s) 69, 149, 153, 191
FaqI GGGAC 1 cut(s) 194
Fnu4HI GCNGC 2 cut(s) 194, 197
FokI GGATG 1 cut(s) 85
Fsp4HI GCNGC 2 cut(s) 194, 197
FspBI CTAG 2 cut(s) 101, 212
GluI GCNGC 2 cut(s) 194, 197
HinfI GANTC 1 cut(s) 104
Hpy188III TCNNGA 2 cut(s) 62, 170
HpyCH4III ACNGT 1 cut(s) 219
HpyCH4V TGCA 1 cut(s) 193
HpyF3I CTNAG 1 cut(s) 168
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 2 cut(s) 67, 155
Lsp1109I GCAGC 2 cut(s) 205, 208
MaeI CTAG 2 cut(s) 101, 212
MaeIII GTNAC 1 cut(s) 163
MfeI CAATTG 1 cut(s) 81
MluCI AATT 3 cut(s) 81, 87, 175
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 188
MunI CAATTG 1 cut(s) 81
NlaIV GGNNCC 1 cut(s) 78
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 2 cut(s) 195, 198
PspN4I GGNNCC 1 cut(s) 78
RsaI GTAC 1 cut(s) 216
RsaNI GTAC 1 cut(s) 215
RseI CAYNNNNRTG 1 cut(s) 188
SaqAI TTAA 1 cut(s) 5
SatI GCNGC 2 cut(s) 194, 197
SetI ASST 3 cut(s) 16, 204, 213
SgeI CNNG 7 cut(s) 43, 56, 66, 74, 113, 182, 218
SmiMI CAYNNNNRTG 1 cut(s) 188
Sse9I AATT 3 cut(s) 81, 87, 175
SspMI CTAG 2 cut(s) 101, 212
TaaI ACNGT 1 cut(s) 219
TaqI TCGA 1 cut(s) 207
TasI AATT 3 cut(s) 81, 87, 175
TatI WGTACW 1 cut(s) 214
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TseI GCWGC 2 cut(s) 193, 196
XspI CTAG 2 cut(s) 101, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.