Rroxscaffold_7G00190390

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
30489239 .. 30496571
7333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00190390.1

Sequence Viewer

Length: 180 bp
ATGTGTAGAAAATGGAAACAGGGGGTGAAGCAAAGTCTGGGACGGATAGAGAGATTGAACTTTGCTGGTTGGAAGATGGATGATGACTCCTCCGCTCGTCTGCTTTGCTATGCTTACAGCCTCAGAGACTTGGATATAATTTTTGGGTGTGACAACTCTAGCTGGAGAACAAGAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.92

Weight (kDa)

9.3

Isoelectric Point (pI)

56.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 95
AciI CCGC 1 cut(s) 93
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 37
BccI CCATC 1 cut(s) 70
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 1 cut(s) 159
BseGI GGATG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 136
BseRI GAGGAG 1 cut(s) 79
BslFI GGGAC 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 120
BsmFI GGGAC 1 cut(s) 54
BspACI CCGC 1 cut(s) 93
BspCNI CTCAG 1 cut(s) 135
BsrBI CCGCTC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 122
BstF5I GGATG 1 cut(s) 85
BstMAI GTCTC 1 cut(s) 120
BtsCI GGATG 1 cut(s) 85
CviJI RGCY 2 cut(s) 120, 162
CviKI_1 RGCY 2 cut(s) 120, 162
DdeI CTNAG 1 cut(s) 122
FaiI YATR 2 cut(s) 111, 137
FaqI GGGAC 1 cut(s) 54
FokI GGATG 1 cut(s) 92
FspBI CTAG 1 cut(s) 159
HinfI GANTC 1 cut(s) 86
HphI GGTGA 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 122
LpnPI CCDG 4 cut(s) 5, 23, 51, 148
MaeI CTAG 1 cut(s) 159
MaeIII GTNAC 1 cut(s) 149
MbiI CCGCTC 1 cut(s) 95
MboII GAAGA 1 cut(s) 85
MluCI AATT 1 cut(s) 138
MlyI GAGTC 1 cut(s) 80
MmeI TCCRAC 1 cut(s) 50
MnlI CCTC 3 cut(s) 100, 131, 167
NmuCI GTSAC 1 cut(s) 149
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
SchI GAGTC 1 cut(s) 80
SetI ASST 1 cut(s) 164
SgeI CNNG 7 cut(s) 32, 50, 78, 108, 142, 171, 175
Sse9I AATT 1 cut(s) 138
SsiI CCGC 1 cut(s) 93
SspMI CTAG 1 cut(s) 159
TasI AATT 1 cut(s) 138
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
TspGWI ACGGA 1 cut(s) 58
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.