Rorug01G0178900

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
24569860 .. 24570126
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0178900.1

Sequence Viewer

Length: 267 bp
ATGTGGCCCTTGTATGCCGAGCAACAACTTAATGCATTTCAGCTAGTTACGGAACTAGGTATAGCTGTGGAAATTGATATGAGTTATAGGAAGGATGGTCCAGTTGTTGTGACTGCAGAGAAGATTGAGAGTGGAATAAAGGAGCTAATGGAGCTTGATAGTGATATAAGGAAGAGGGTGAAACAGATGAGTGATAATAGCAAAAAAACTTTGATGGATGGGGGGTTCTCATATGCTGCGTTGGGCCACTTCATTGATCAAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.93

Weight (kDa)

4.84

Isoelectric Point (pI)

49.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AloI GAACNNNNNNTCC 2 cut(s) 209, 241
AluBI AGCT 4 cut(s) 43, 65, 145, 154
AluI AGCT 4 cut(s) 43, 65, 145, 154
AoxI GGCC 2 cut(s) 5, 244
ApeKI GCWGC 1 cut(s) 236
AspS9I GGNCC 3 cut(s) 6, 98, 244
AsuHPI GGTGA 1 cut(s) 190
AvaII GGWCC 1 cut(s) 98
BbvI GCAGC 1 cut(s) 223
BccI CCATC 3 cut(s) 89, 208, 212
BclI TGATCA 1 cut(s) 256
BfaI CTAG 2 cut(s) 44, 56
BfmI CTRYAG 1 cut(s) 114
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
Bme18I GGWCC 1 cut(s) 98
BmgT120I GGNCC 3 cut(s) 6, 98, 244
Bse1I ACTGG 1 cut(s) 101
BseGI GGATG 2 cut(s) 100, 223
BseNI ACTGG 1 cut(s) 101
BseXI GCAGC 1 cut(s) 223
BshFI GGCC 2 cut(s) 7, 246
BsnI GGCC 2 cut(s) 7, 246
Bsp143I GATC 1 cut(s) 256
BspANI GGCC 2 cut(s) 7, 246
BspMAI CTGCAG 1 cut(s) 118
BsrI ACTGG 1 cut(s) 101
BssMI GATC 1 cut(s) 256
Bst6I CTCTTC 1 cut(s) 167
BstF5I GGATG 2 cut(s) 100, 223
BstKTI GATC 1 cut(s) 259
BstMBI GATC 1 cut(s) 256
BstMWI GCNNNNNNNGC 1 cut(s) 151
BstSFI CTRYAG 1 cut(s) 114
BstV1I GCAGC 1 cut(s) 223
BsuRI GGCC 2 cut(s) 7, 246
BtsCI GGATG 2 cut(s) 100, 223
Cfr13I GGNCC 3 cut(s) 6, 98, 244
CviJI RGCY 6 cut(s) 7, 43, 65, 145, 154, 246
CviKI_1 RGCY 6 cut(s) 7, 43, 65, 145, 154, 246
DpnI GATC 1 cut(s) 258
DpnII GATC 1 cut(s) 256
Eam1104I CTCTTC 1 cut(s) 167
EarI CTCTTC 1 cut(s) 167
Eco47I GGWCC 1 cut(s) 98
EcoT22I ATGCAT 1 cut(s) 37
FaiI YATR 7 cut(s) 15, 62, 80, 87, 167, 232, 234
FauNDI CATATG 1 cut(s) 232
FbaI TGATCA 1 cut(s) 256
Fnu4HI GCNGC 1 cut(s) 237
FokI GGATG 2 cut(s) 107, 230
Fsp4HI GCNGC 1 cut(s) 237
FspBI CTAG 2 cut(s) 44, 56
GluI GCNGC 1 cut(s) 237
HaeIII GGCC 2 cut(s) 7, 246
HphI GGTGA 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 85
HpyCH4V TGCA 2 cut(s) 35, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 151
Ksp22I TGATCA 1 cut(s) 256
Kzo9I GATC 1 cut(s) 256
LmnI GCTCC 2 cut(s) 142, 151
LpnPI CCDG 1 cut(s) 114
Lsp1109I GCAGC 1 cut(s) 223
MaeI CTAG 2 cut(s) 44, 56
MaeIII GTNAC 2 cut(s) 46, 109
MalI GATC 1 cut(s) 258
MboI GATC 1 cut(s) 256
MboII GAAGA 2 cut(s) 133, 184
MluCI AATT 1 cut(s) 72
MnlI CCTC 1 cut(s) 168
Mph1103I ATGCAT 1 cut(s) 37
MseI TTAA 2 cut(s) 30, 265
MwoI GCNNNNNNNGC 1 cut(s) 151
NdeI CATATG 1 cut(s) 232
NdeII GATC 1 cut(s) 256
NmeAIII GCCGAG 1 cut(s) 43
NmuCI GTSAC 1 cut(s) 109
NsiI ATGCAT 1 cut(s) 37
PkrI GCNGC 1 cut(s) 238
PspPI GGNCC 3 cut(s) 6, 98, 244
PstI CTGCAG 1 cut(s) 118
SaqAI TTAA 2 cut(s) 30, 265
SatI GCNGC 1 cut(s) 237
Sau3AI GATC 1 cut(s) 256
Sau96I GGNCC 3 cut(s) 6, 98, 244
SetI ASST 5 cut(s) 45, 61, 67, 147, 156
SfcI CTRYAG 1 cut(s) 114
SgeI CNNG 6 cut(s) 22, 31, 56, 68, 113, 167
SinI GGWCC 1 cut(s) 98
Sse9I AATT 1 cut(s) 72
SspMI CTAG 2 cut(s) 44, 56
TasI AATT 1 cut(s) 72
Tru1I TTAA 2 cut(s) 30, 265
Tru9I TTAA 2 cut(s) 30, 265
TseFI GTSAC 1 cut(s) 109
TseI GCWGC 1 cut(s) 236
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 241
TspGWI ACGGA 1 cut(s) 65
VpaK11BI GGWCC 1 cut(s) 98
XspI CTAG 2 cut(s) 44, 56
Zsp2I ATGCAT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.