Rorug01G0241000

O-glucosyltransferase rumi homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0004904
Physical Location & Seq
Forward (+)
34610236 .. 34610427
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0241000.1

Sequence Viewer

Length: 192 bp
ATGTGGAAACTTCATCTACCTCCTAAAATCAAGGTTTTCTCTTGGCAACTTATTCGCGGACGTCTTAAAACTAGAGATACTATTTTCACTAATTTGTTTATTAACCGATCTTATCCTTTTTGTTCTTCTGACATGGAATCGATTAATCATCTTTTCTTTAAAAACAATTCTCAGGTTCACCCCTTGGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00514 map00514
Pfam Domains
Protein Families
Glyco_transf_90

Protein Analysis

63

Amino Acids

7.55

Weight (kDa)

10.29

Isoelectric Point (pI)

20.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RVT PF13966 1 - 55 9.4e-11 zinc-binding in reverse transcriptase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 64
AccII CGCG 1 cut(s) 57
AciI CCGC 1 cut(s) 57
AcyI GRCGYC 1 cut(s) 61
AseI ATTAAT 1 cut(s) 144
AsuHPI GGTGA 1 cut(s) 170
BcgI CGANNNNNNTGC 2 cut(s) 35, 69
BfaI CTAG 1 cut(s) 72
Bsa29I ATCGAT 1 cut(s) 140
BsaHI GRCGYC 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 183
BseCI ATCGAT 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 183
BseMII CTCAG 1 cut(s) 185
Bsh1236I CGCG 1 cut(s) 57
BshVI ATCGAT 1 cut(s) 140
Bsp143I GATC 1 cut(s) 107
BspACI CCGC 1 cut(s) 57
BspCNI CTCAG 1 cut(s) 184
BspDI ATCGAT 1 cut(s) 140
BspFNI CGCG 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 183
BssMI GATC 1 cut(s) 107
BssNI GRCGYC 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 183
BstACI GRCGYC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 171
BstFNI CGCG 1 cut(s) 57
BstKTI GATC 1 cut(s) 110
BstMBI GATC 1 cut(s) 107
BstUI CGCG 1 cut(s) 57
Bsu15I ATCGAT 1 cut(s) 140
BsuTUI ATCGAT 1 cut(s) 140
ClaI ATCGAT 1 cut(s) 140
CviAII CATG 1 cut(s) 133
DdeI CTNAG 1 cut(s) 171
DpnI GATC 1 cut(s) 109
DpnII GATC 1 cut(s) 107
DraI TTTAAA 1 cut(s) 160
Eco130I CCWWGG 1 cut(s) 183
EcoT14I CCWWGG 1 cut(s) 183
ErhI CCWWGG 1 cut(s) 183
FaeI CATG 1 cut(s) 136
FaiI YATR 1 cut(s) 134
FatI CATG 1 cut(s) 132
FspBI CTAG 1 cut(s) 72
Hin1I GRCGYC 1 cut(s) 61
Hin1II CATG 1 cut(s) 136
HinfI GANTC 1 cut(s) 137
HphI GGTGA 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 178
HpyCH4IV ACGT 1 cut(s) 61
HpyF3I CTNAG 1 cut(s) 171
HpySE526I ACGT 1 cut(s) 61
Hsp92I GRCGYC 1 cut(s) 61
Hsp92II CATG 1 cut(s) 136
Kzo9I GATC 1 cut(s) 107
LpnPI CCDG 1 cut(s) 158
MaeI CTAG 1 cut(s) 72
MaeII ACGT 1 cut(s) 61
MalI GATC 1 cut(s) 109
MboI GATC 1 cut(s) 107
MboII GAAGA 1 cut(s) 117
MluCI AATT 2 cut(s) 91, 166
MnlI CCTC 1 cut(s) 30
MseI TTAA 4 cut(s) 66, 102, 144, 159
MvnI CGCG 1 cut(s) 57
NdeII GATC 1 cut(s) 107
NlaIII CATG 1 cut(s) 136
PfeI GAWTC 1 cut(s) 137
PshBI ATTAAT 1 cut(s) 144
SaqAI TTAA 4 cut(s) 66, 102, 144, 159
Sau3AI GATC 1 cut(s) 107
SetI ASST 4 cut(s) 22, 36, 64, 177
SgeI CNNG 6 cut(s) 43, 54, 68, 84, 145, 185
Sse9I AATT 2 cut(s) 91, 166
SsiI CCGC 1 cut(s) 57
SspMI CTAG 1 cut(s) 72
StyI CCWWGG 1 cut(s) 183
TaiI ACGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 140
TasI AATT 2 cut(s) 91, 166
TfiI GAWTC 1 cut(s) 137
Tru1I TTAA 4 cut(s) 66, 102, 144, 159
Tru9I TTAA 4 cut(s) 66, 102, 144, 159
VspI ATTAAT 1 cut(s) 144
XspI CTAG 1 cut(s) 72
ZraI GACGTC 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.