Rorug01G0470200

Chlororespiratory reduction 6

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
56183078 .. 56183260
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0470200.1

Sequence Viewer

Length: 183 bp
ATGGGCTCGCTTATTTGTTGGTGTAAAAATTTGATCAGAAGCTTCCATTGCTTCTCCCTAAAGCACATTTACAAAGAAAGTAATATGGTAGCAGATTGCCTTGCTAAGGAAAGCATCAATCATGCTTATGGGATAATTGAGTTTCATGGTCCTCCCATTCATGCCTCTTCTGCTTATCTATGA

Protein Analysis

60

Amino Acids

6.8

Weight (kDa)

7.73

Isoelectric Point (pI)

46.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012411)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 106
AluBI AGCT 1 cut(s) 42
AluI AGCT 1 cut(s) 42
ApoI RAATTY 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 149
AvaII GGWCC 1 cut(s) 149
BanII GRGCYC 1 cut(s) 8
BclI TGATCA 1 cut(s) 33
Bme18I GGWCC 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 149
BmsI GCATC 1 cut(s) 123
Bpu10I CCTNAGC 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 106
Bse3DI GCAATG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 106
BseMI GCAATG 1 cut(s) 46
BslI CCNNNNNNNGG 1 cut(s) 106
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 33
BsrDI GCAATG 1 cut(s) 46
BssMI GATC 1 cut(s) 33
Bst6I CTCTTC 1 cut(s) 172
BstC8I GCNNGC 1 cut(s) 8
BstDEI CTNAG 1 cut(s) 105
BstENI CCTNNNNNAGG 1 cut(s) 104
BstKTI GATC 1 cut(s) 36
BstMBI GATC 1 cut(s) 33
BstMWI GCNNNNNNNGC 2 cut(s) 48, 170
Cac8I GCNNGC 1 cut(s) 8
Cfr13I GGNCC 1 cut(s) 149
CviAII CATG 3 cut(s) 122, 146, 161
CviJI RGCY 2 cut(s) 6, 42
CviKI_1 RGCY 2 cut(s) 6, 42
DdeI CTNAG 1 cut(s) 105
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
Eam1104I CTCTTC 1 cut(s) 172
EarI CTCTTC 1 cut(s) 172
Eco24I GRGCYC 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 149
EcoNI CCTNNNNNAGG 1 cut(s) 104
EcoT38I GRGCYC 1 cut(s) 8
FaeI CATG 3 cut(s) 125, 149, 164
FaiI YATR 6 cut(s) 86, 123, 129, 147, 162, 181
FatI CATG 3 cut(s) 121, 145, 160
FbaI TGATCA 1 cut(s) 33
FriOI GRGCYC 1 cut(s) 8
Hin1II CATG 3 cut(s) 125, 149, 164
HindIII AAGCTT 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 48, 170
HpyF3I CTNAG 1 cut(s) 105
Hsp92II CATG 3 cut(s) 125, 149, 164
Ksp22I TGATCA 1 cut(s) 33
Kzo9I GATC 1 cut(s) 33
LweI GCATC 1 cut(s) 123
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MboII GAAGA 1 cut(s) 159
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 28, 135
MnlI CCTC 2 cut(s) 162, 175
MslI CAYNNNNRTG 1 cut(s) 126
MwoI GCNNNNNNNGC 2 cut(s) 48, 170
NdeII GATC 1 cut(s) 33
NlaIII CATG 3 cut(s) 125, 149, 164
PspPI GGNCC 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 126
Sau3AI GATC 1 cut(s) 33
Sau96I GGNCC 1 cut(s) 149
SduI GDGCHC 1 cut(s) 8
SetI ASST 1 cut(s) 44
SfaNI GCATC 1 cut(s) 123
SgeI CNNG 5 cut(s) 19, 113, 134, 158, 173
SinI GGWCC 1 cut(s) 149
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 2 cut(s) 28, 135
TasI AATT 2 cut(s) 28, 135
TspDTI ATGAA 2 cut(s) 134, 149
VpaK11BI GGWCC 1 cut(s) 149
XagI CCTNNNNNAGG 1 cut(s) 104
XapI RAATTY 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.