Rorug02G0302400

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
33763380 .. 33763679
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0302400.1

Sequence Viewer

Length: 300 bp
ATGGGTTTCCGGCTACCTGTAATTGTTAGCTCCAAGAGAAGTCTTGCCCGATCTTCATCTAATGCGAACAAGACAGCTTCAAAGACCTTAGATATCCCAAAAGGCTACTTTGCGGTCTATGTTGGAGAGAGCCAGAAGAAGCGATTTTTGATTCCAATATCATACTTGAACCAACCTTCATTTATGGTTTTGCTGAGTCAAGCTGAAGAAGAATTTGGATATGATCATCCCATGGGCGGTATCACAATCCCCTGCAGTGAAGACATCTTCCTTGATCTCACTTCCCGCTTAAGTGTGTGA

Protein Analysis

99

Amino Acids

10.99

Weight (kDa)

8.82

Isoelectric Point (pI)

53.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 15 - 96 4.2e-24 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 113, 237, 286
AcsI RAATTY 1 cut(s) 212
AcuI CTGAAG 1 cut(s) 225
AfiI CCNNNNNNNGG 1 cut(s) 236
AflII CTTAAG 1 cut(s) 289
AgsI TTSAA 2 cut(s) 81, 169
AjuI GAANNNNNNNTTGG 2 cut(s) 198, 230
AluBI AGCT 3 cut(s) 30, 77, 203
AluI AGCT 3 cut(s) 30, 77, 203
ApoI RAATTY 1 cut(s) 212
BbsI GAAGAC 1 cut(s) 267
BclI TGATCA 1 cut(s) 223
BfmI CTRYAG 1 cut(s) 253
BfrI CTTAAG 1 cut(s) 289
BpiI GAAGAC 1 cut(s) 267
BsaBI GATNNNNATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 231
Bsc4I CCNNNNNNNGG 1 cut(s) 236
Bse8I GATNNNNATC 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 231
BseGI GGATG 1 cut(s) 226
BseJI GATNNNNATC 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 236
BseMII CTCAG 1 cut(s) 185
BsiSI CCGG 1 cut(s) 10
BslI CCNNNNNNNGG 1 cut(s) 236
Bsp143I GATC 3 cut(s) 50, 223, 274
Bsp19I CCATGG 1 cut(s) 231
BspACI CCGC 3 cut(s) 113, 237, 286
BspCNI CTCAG 1 cut(s) 186
BspMAI CTGCAG 1 cut(s) 257
BspTI CTTAAG 1 cut(s) 289
BssECI CCNNGG 1 cut(s) 231
BssMI GATC 3 cut(s) 50, 223, 274
BssT1I CCWWGG 1 cut(s) 231
BstAFI CTTAAG 1 cut(s) 289
BstDEI CTNAG 2 cut(s) 88, 194
BstDSI CCRYGG 1 cut(s) 231
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 3 cut(s) 53, 226, 277
BstMBI GATC 3 cut(s) 50, 223, 274
BstSFI CTRYAG 1 cut(s) 253
BstV2I GAAGAC 1 cut(s) 267
BtgI CCRYGG 1 cut(s) 231
BtsCI GGATG 1 cut(s) 226
BtsI GCAGTG 1 cut(s) 262
BtsIMutI CAGTG 1 cut(s) 262
CviAII CATG 1 cut(s) 232
CviJI RGCY 6 cut(s) 13, 30, 77, 105, 132, 203
CviKI_1 RGCY 6 cut(s) 13, 30, 77, 105, 132, 203
DdeI CTNAG 2 cut(s) 88, 194
DpnI GATC 3 cut(s) 52, 225, 276
DpnII GATC 3 cut(s) 50, 223, 274
Eco130I CCWWGG 1 cut(s) 231
Eco32I GATATC 1 cut(s) 94
Eco57I CTGAAG 1 cut(s) 225
EcoRV GATATC 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
FaeI CATG 1 cut(s) 235
FaiI YATR 5 cut(s) 120, 163, 185, 222, 233
FatI CATG 1 cut(s) 231
FauI CCCGC 1 cut(s) 293
FbaI TGATCA 1 cut(s) 223
FokI GGATG 1 cut(s) 213
HapII CCGG 1 cut(s) 10
Hin1II CATG 1 cut(s) 235
HinfI GANTC 2 cut(s) 151, 196
HpaII CCGG 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 186
HpyCH4V TGCA 1 cut(s) 255
HpyF3I CTNAG 2 cut(s) 88, 194
Hsp92II CATG 1 cut(s) 235
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 3 cut(s) 50, 223, 274
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 4 cut(s) 23, 30, 146, 265
MalI GATC 3 cut(s) 52, 225, 276
MboI GATC 3 cut(s) 50, 223, 274
MboII GAAGA 6 cut(s) 45, 148, 218, 221, 259, 272
MluCI AATT 2 cut(s) 21, 212
MlyI GAGTC 1 cut(s) 205
MmeI TCCRAC 1 cut(s) 103
MseI TTAA 1 cut(s) 290
MspCI CTTAAG 1 cut(s) 289
MspI CCGG 1 cut(s) 10
NcoI CCATGG 1 cut(s) 231
NdeII GATC 3 cut(s) 50, 223, 274
NlaIII CATG 1 cut(s) 235
PfeI GAWTC 1 cut(s) 151
PleI GAGTC 1 cut(s) 204
PpsI GAGTC 1 cut(s) 204
PstI CTGCAG 1 cut(s) 257
SaqAI TTAA 1 cut(s) 290
Sau3AI GATC 3 cut(s) 50, 223, 274
SchI GAGTC 1 cut(s) 205
SetI ASST 6 cut(s) 19, 32, 79, 89, 178, 205
SfcI CTRYAG 1 cut(s) 253
SmlI CTYRAG 1 cut(s) 289
SmoI CTYRAG 1 cut(s) 289
Sse9I AATT 2 cut(s) 21, 212
SsiI CCGC 3 cut(s) 113, 237, 286
StyI CCWWGG 1 cut(s) 231
TasI AATT 2 cut(s) 21, 212
TfiI GAWTC 1 cut(s) 151
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TscAI CASTG 1 cut(s) 262
TspDTI ATGAA 2 cut(s) 45, 168
TspRI CASTG 1 cut(s) 262
Vha464I CTTAAG 1 cut(s) 289
XapI RAATTY 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.