Rorug02G0305100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0005920
Physical Location & Seq
Forward (+)
34496227 .. 34497114
888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0305100.1

Sequence Viewer

Length: 180 bp
ATGACCAAGACGACAGAGACACAAGATAACCAACCTCCAGCAGGATACCCAACTGCAACCAATGATCCCCCAACTAGGAAGAAGTTTCGGTCACGGACTAAAAAGAAAGGAGATAGGGGCTTCATTGAGGGCTGCCTATTTGCCTTGTGCTGCTGTTGGCTTTGCGAGGAATGCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.72

Weight (kDa)

8.61

Isoelectric Point (pI)

60.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CYSTM PF12734 15 - 59 7.5e-14 Cysteine-rich TM module stress tolerance
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AfiI CCNNNNNNNGG 2 cut(s) 41, 75
Alw26I GTCTC 1 cut(s) 11
AlwI GGATC 1 cut(s) 59
ApeKI GCWGC 2 cut(s) 132, 150
BbvI GCAGC 2 cut(s) 119, 137
BciVI GTATCC 1 cut(s) 38
BcoDI GTCTC 1 cut(s) 11
BfaI CTAG 1 cut(s) 75
BfuI GTATCC 1 cut(s) 38
BisI GCNGC 2 cut(s) 133, 151
BlsI GCNGC 2 cut(s) 134, 152
BpmI CTGGAG 1 cut(s) 21
Bsc4I CCNNNNNNNGG 2 cut(s) 41, 75
BseLI CCNNNNNNNGG 2 cut(s) 41, 75
BseXI GCAGC 2 cut(s) 119, 137
BslI CCNNNNNNNGG 2 cut(s) 41, 75
BsmAI GTCTC 1 cut(s) 11
BsmI GAATGC 1 cut(s) 176
Bsp143I GATC 1 cut(s) 64
BspPI GGATC 1 cut(s) 59
BssMI GATC 1 cut(s) 64
BstENI CCTNNNNNAGG 1 cut(s) 39
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 11
BstMBI GATC 1 cut(s) 64
BstMWI GCNNNNNNNGC 1 cut(s) 171
BstV1I GCAGC 2 cut(s) 119, 137
BsuI GTATCC 1 cut(s) 38
CviJI RGCY 3 cut(s) 120, 132, 160
CviKI_1 RGCY 3 cut(s) 120, 132, 160
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
EcoNI CCTNNNNNAGG 1 cut(s) 39
Fnu4HI GCNGC 2 cut(s) 133, 151
Fsp4HI GCNGC 2 cut(s) 133, 151
FspBI CTAG 1 cut(s) 75
GluI GCNGC 2 cut(s) 133, 151
GsuI CTGGAG 1 cut(s) 21
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 171
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 2 cut(s) 27, 51
Lsp1109I GCAGC 2 cut(s) 119, 137
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 1 cut(s) 90
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 1 cut(s) 91
MnlI CCTC 3 cut(s) 45, 121, 160
Mva1269I GAATGC 1 cut(s) 176
MwoI GCNNNNNNNGC 1 cut(s) 171
NdeII GATC 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 90
PctI GAATGC 1 cut(s) 176
PkrI GCNGC 2 cut(s) 134, 152
SatI GCNGC 2 cut(s) 133, 151
Sau3AI GATC 1 cut(s) 64
SetI ASST 1 cut(s) 37
SgeI CNNG 7 cut(s) 19, 35, 50, 54, 87, 105, 157
SspMI CTAG 1 cut(s) 75
TaqII GACCGA 1 cut(s) 78
TseFI GTSAC 1 cut(s) 90
TseI GCWGC 2 cut(s) 132, 150
Tsp45I GTSAC 1 cut(s) 90
TspDTI ATGAA 1 cut(s) 112
TspGWI ACGGA 1 cut(s) 109
XagI CCTNNNNNAGG 1 cut(s) 39
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.