Rorug02G0427700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0011396
Physical Location & Seq
Reverse (-)
54846836 .. 54847601
766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0427700.1

Sequence Viewer

Length: 600 bp
ATGCTCATTTTGGGTCCAAACACTTTCAACAGTTGGATTCTTACTGCTAGAGACCTGCCGATATTAACCATGTTGGAGATGATAAGGTGTAATTTAATGAGGAGATATCAAGTTAAAAGACAACAAATTACTGAATTTCAGAATGTGGTATGTCCCGAAATTCAGAAGAAGCTGAACAAGGCCATTCATGCATCTAGGGAGAAACCAGAGGCATATGTTGATAAATATTACCATAAGGAGACTTACTTGAAAGCTTATGAGCCTATGATTCACCCAATTAAAGGGTTTGACATGTGGCCTACGTGTAATCAAGAGCCACTCTTGCCCCCATTGGTGAAAAAGCAACCAGGTAGGCCAAAGAAGGTTAGGCGGAAGGACCCAGAAATGGAGAAAGATCCTAACAATCCTATGCAGGTTCTGAGTAGAAAGGGAAAAACCACTACATGTACCAAGTGTTATGGAAAAGGACACAATAGGAGAAGTTGGAAAAATCAGCCTGTAGATGTCCCCCCAAATGTATATGTTGATAAAAGATATGCTTATCCAAGGTCAGCAAATGTTACTGTAAAAAAAGGTCAAGAAAGTGGTGAAACTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

199

Amino Acids

23.3

Weight (kDa)

9.79

Isoelectric Point (pI)

48.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011396)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G06510
fragaria_vesca FvH4_6g38360 FvH4_6g38360
malus_domestica MD09G1150800.v1.1 MD17G1138200.v1.1
prunus_persica Prupe.3G174200_v2.0.a1
pyrus_communis pycom09g07060 pycom17g13140
rosa_chinensis RchiOBHm_Chr2g0151671
rosa_laevigata RLG00000020567
rosa_multiflora Rmu_sc0005294.1_g000050
rosa_roxburghii Rroxscaffold_2G00096270
rosa_rugosa Rorug02G0427700 Rorug02G0427800 Rorug02G0427900
rosa_samantha Rh2AG488600 Rh2BG501300 Rh2CG475100 Rh2DG512400
rosa_wichuraiana Rw2G040070

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 63, 403
AciI CCGC 1 cut(s) 370
AclWI GGATC 1 cut(s) 389
AcsI RAATTY 2 cut(s) 134, 159
AfaI GTAC 1 cut(s) 448
AfiI CCNNNNNNNGG 2 cut(s) 281, 385
AflIII ACRYGT 3 cut(s) 291, 302, 443
AgsI TTSAA 2 cut(s) 28, 250
AjnI CCWGG 1 cut(s) 346
AluBI AGCT 2 cut(s) 172, 254
AluI AGCT 2 cut(s) 172, 254
Alw26I GTCTC 2 cut(s) 45, 233
AlwI GGATC 1 cut(s) 389
AlwNI CAGNNNCTG 1 cut(s) 418
AoxI GGCC 3 cut(s) 180, 296, 353
ApoI RAATTY 2 cut(s) 134, 159
AspS9I GGNCC 2 cut(s) 14, 376
AsuHPI GGTGA 3 cut(s) 263, 346, 599
AvaII GGWCC 2 cut(s) 14, 376
BciT130I CCWGG 1 cut(s) 348
BcoDI GTCTC 2 cut(s) 45, 233
BfaI CTAG 2 cut(s) 48, 195
BfmI CTRYAG 1 cut(s) 498
BfuAI ACCTGC 2 cut(s) 63, 403
Bme1390I CCNGG 1 cut(s) 348
Bme18I GGWCC 2 cut(s) 14, 376
BmgT120I GGNCC 2 cut(s) 14, 376
BmiI GGNNCC 2 cut(s) 15, 378
BmrFI CCNGG 1 cut(s) 348
BmsI GCATC 1 cut(s) 200
BsaAI YACGTR 1 cut(s) 303
BsaI GGTCTC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 545
Bsc4I CCNNNNNNNGG 2 cut(s) 281, 385
BseBI CCWGG 1 cut(s) 348
BseDI CCNNGG 1 cut(s) 545
BseLI CCNNNNNNNGG 2 cut(s) 281, 385
BseMII CTCAG 1 cut(s) 410
BseRI GAGGAG 1 cut(s) 115
BshFI GGCC 3 cut(s) 182, 298, 355
BslFI GGGAC 2 cut(s) 138, 491
BslI CCNNNNNNNGG 2 cut(s) 281, 385
BsmAI GTCTC 2 cut(s) 45, 233
BsmFI GGGAC 2 cut(s) 138, 491
BsnI GGCC 3 cut(s) 182, 298, 355
Bso31I GGTCTC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 394
BspACI CCGC 1 cut(s) 370
BspANI GGCC 3 cut(s) 182, 298, 355
BspCNI CTCAG 1 cut(s) 411
BspLI GGNNCC 2 cut(s) 15, 378
BspMI ACCTGC 2 cut(s) 63, 403
BspPI GGATC 1 cut(s) 389
BspTNI GGTCTC 1 cut(s) 45
BssECI CCNNGG 1 cut(s) 545
BssMI GATC 1 cut(s) 394
BssT1I CCWWGG 1 cut(s) 545
Bst2UI CCWGG 1 cut(s) 348
Bst4CI ACNGT 2 cut(s) 32, 565
BstBAI YACGTR 1 cut(s) 303
BstDEI CTNAG 1 cut(s) 419
BstKTI GATC 1 cut(s) 397
BstMAI GTCTC 2 cut(s) 45, 233
BstMBI GATC 1 cut(s) 394
BstMWI GCNNNNNNNGC 2 cut(s) 188, 322
BstNI CCWGG 1 cut(s) 348
BstNSI RCATGY 2 cut(s) 295, 447
BstSCI CCNGG 1 cut(s) 346
BstSFI CTRYAG 1 cut(s) 498
BstX2I RGATCY 1 cut(s) 394
BstYI RGATCY 1 cut(s) 394
BsuRI GGCC 3 cut(s) 182, 298, 355
BveI ACCTGC 2 cut(s) 63, 403
CaiI CAGNNNCTG 1 cut(s) 418
Cfr13I GGNCC 2 cut(s) 14, 376
CsiI ACCWGGT 1 cut(s) 346
Csp6I GTAC 1 cut(s) 447
CviAII CATG 4 cut(s) 70, 188, 292, 444
CviJI RGCY 8 cut(s) 172, 182, 254, 262, 298, 316, 355, 496
CviKI_1 RGCY 8 cut(s) 172, 182, 254, 262, 298, 316, 355, 496
CviQI GTAC 1 cut(s) 447
DdeI CTNAG 1 cut(s) 419
DpnI GATC 1 cut(s) 396
DpnII GATC 1 cut(s) 394
EciI GGCGGA 1 cut(s) 385
Eco130I CCWWGG 1 cut(s) 545
Eco31I GGTCTC 1 cut(s) 45
Eco32I GATATC 1 cut(s) 107
Eco47I GGWCC 2 cut(s) 14, 376
EcoO109I RGGNCCY 1 cut(s) 376
EcoRII CCWGG 1 cut(s) 346
EcoRV GATATC 1 cut(s) 107
EcoT14I CCWWGG 1 cut(s) 545
EcoT22I ATGCAT 1 cut(s) 193
ErhI CCWWGG 1 cut(s) 545
FaeI CATG 4 cut(s) 73, 191, 295, 447
FalI AAGNNNNNCTT 2 cut(s) 523, 555
FaqI GGGAC 2 cut(s) 138, 491
FatI CATG 4 cut(s) 69, 187, 291, 443
FauNDI CATATG 1 cut(s) 214
FspBI CTAG 2 cut(s) 48, 195
HaeIII GGCC 3 cut(s) 182, 298, 355
Hin1II CATG 4 cut(s) 73, 191, 295, 447
HindIII AAGCTT 1 cut(s) 252
HinfI GANTC 2 cut(s) 37, 268
HphI GGTGA 3 cut(s) 263, 346, 599
Hpy188I TCNGA 3 cut(s) 141, 165, 420
Hpy188III TCNNGA 3 cut(s) 155, 311, 578
HpyAV CCTTC 2 cut(s) 355, 367
HpyCH4III ACNGT 2 cut(s) 32, 565
HpyCH4IV ACGT 1 cut(s) 302
HpyCH4V TGCA 2 cut(s) 191, 412
HpyF10VI GCNNNNNNNGC 2 cut(s) 188, 322
HpyF3I CTNAG 1 cut(s) 419
HpySE526I ACGT 1 cut(s) 302
Hsp92II CATG 4 cut(s) 73, 191, 295, 447
Kzo9I GATC 1 cut(s) 394
LpnPI CCDG 7 cut(s) 68, 219, 333, 360, 393, 398, 510
LweI GCATC 1 cut(s) 200
MabI ACCWGGT 1 cut(s) 346
MaeI CTAG 2 cut(s) 48, 195
MaeII ACGT 1 cut(s) 302
MaeIII GTNAC 1 cut(s) 559
MalI GATC 1 cut(s) 396
MboI GATC 1 cut(s) 394
MboII GAAGA 1 cut(s) 178
MflI RGATCY 1 cut(s) 394
MluCI AATT 5 cut(s) 91, 126, 134, 159, 276
MmeI TCCRAC 3 cut(s) 14, 54, 464
MnlI CCTC 2 cut(s) 93, 202
Mph1103I ATGCAT 1 cut(s) 193
MseI TTAA 4 cut(s) 65, 95, 114, 279
MspR9I CCNGG 1 cut(s) 348
MvaI CCWGG 1 cut(s) 348
MwoI GCNNNNNNNGC 2 cut(s) 188, 322
NdeI CATATG 1 cut(s) 214
NdeII GATC 1 cut(s) 394
NlaIII CATG 4 cut(s) 73, 191, 295, 447
NlaIV GGNNCC 2 cut(s) 15, 378
NsiI ATGCAT 1 cut(s) 193
NspI RCATGY 2 cut(s) 295, 447
PciI ACATGT 2 cut(s) 291, 443
PfeI GAWTC 2 cut(s) 37, 268
Ppu21I YACGTR 1 cut(s) 303
PpuMI RGGWCCY 1 cut(s) 376
PscI ACATGT 2 cut(s) 291, 443
Psp5II RGGWCCY 1 cut(s) 376
Psp6I CCWGG 1 cut(s) 346
PspGI CCWGG 1 cut(s) 346
PspN4I GGNNCC 2 cut(s) 15, 378
PspPI GGNCC 2 cut(s) 14, 376
PspPPI RGGWCCY 1 cut(s) 376
PstNI CAGNNNCTG 1 cut(s) 418
PsuI RGATCY 1 cut(s) 394
RsaI GTAC 1 cut(s) 448
RsaNI GTAC 1 cut(s) 447
SaqAI TTAA 4 cut(s) 65, 95, 114, 279
Sau3AI GATC 1 cut(s) 394
Sau96I GGNCC 2 cut(s) 14, 376
ScrFI CCNGG 1 cut(s) 348
SexAI ACCWGGT 1 cut(s) 346
SfaNI GCATC 1 cut(s) 200
SfcI CTRYAG 1 cut(s) 498
SinI GGWCC 2 cut(s) 14, 376
Sse9I AATT 5 cut(s) 91, 126, 134, 159, 276
SsiI CCGC 1 cut(s) 370
SspI AATATT 1 cut(s) 227
SspMI CTAG 2 cut(s) 48, 195
StyD4I CCNGG 1 cut(s) 346
StyI CCWWGG 1 cut(s) 545
TaaI ACNGT 2 cut(s) 32, 565
TaiI ACGT 1 cut(s) 305
TasI AATT 5 cut(s) 91, 126, 134, 159, 276
TfiI GAWTC 2 cut(s) 37, 268
Tru1I TTAA 4 cut(s) 65, 95, 114, 279
Tru9I TTAA 4 cut(s) 65, 95, 114, 279
TspDTI ATGAA 2 cut(s) 176, 585
VpaK11BI GGWCC 2 cut(s) 14, 376
XapI RAATTY 2 cut(s) 134, 159
XceI RCATGY 2 cut(s) 295, 447
XspI CTAG 2 cut(s) 48, 195
Zsp2I ATGCAT 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.