Rorug02G0452900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0015719
Physical Location & Seq
Reverse (-)
58223748 .. 58225904
2157 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0452900.1

Sequence Viewer

Length: 399 bp
ATGTCTAAGATCTCACACCAATCAGTGGCTACGCCTACTAGCTTGGCCTCGGTGTCCACTATTCCGGCTTGCAAGGTCAATCAGTTGGTTCAGGTTGCACAGAAGTGCCAGAGTACGATTGTTGAAAGTGGATCTGATGGGGTTTCTCAGCAGGATCTACAAGCAAATAAGGTTGTGAACAACATGAAAGATTTGATCGAATTCTGCCAGGAAAACAAAGTTGGCCCAATTGAGGGCTTGCAGGTTCATCCTCGACATGCGAATGCAACCAAGCTTCAGATGCAAAGGATGCACGAAATGGAGCAGTTAGCAAGTGTTCAGGGCATGCCAACTGATAGGAACACATTGAATAAGCTAATGGTAATAACAACCATCACATGGCCAGGGGAGGAGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

132

Amino Acids

14.5

Weight (kDa)

6.4

Isoelectric Point (pI)

52.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LIM_bind PF01803 37 - 81 8e-06 LIM-domain binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 232
AccB7I CCANNNNNTGG 2 cut(s) 25, 378
AclWI GGATC 2 cut(s) 139, 162
AcoI YGGCCR 1 cut(s) 380
AcsI RAATTY 1 cut(s) 200
AcuI CTGAAG 1 cut(s) 260
AfaI GTAC 1 cut(s) 115
AfiI CCNNNNNNNGG 4 cut(s) 25, 232, 233, 378
AgsI TTSAA 2 cut(s) 125, 349
AjnI CCWGG 2 cut(s) 207, 382
AjuI GAANNNNNNNTTGG 2 cut(s) 204, 236
AleI CACNNNNGTG 1 cut(s) 103
AluBI AGCT 4 cut(s) 42, 274, 355, 394
AluI AGCT 4 cut(s) 42, 274, 355, 394
AlwI GGATC 2 cut(s) 139, 162
AoxI GGCC 3 cut(s) 45, 223, 380
ApoI RAATTY 1 cut(s) 200
AspS9I GGNCC 1 cut(s) 224
BalI TGGCCA 1 cut(s) 382
BccI CCATC 2 cut(s) 131, 380
BciT130I CCWGG 2 cut(s) 209, 384
BfaI CTAG 1 cut(s) 39
BfuAI ACCTGC 1 cut(s) 232
BglII AGATCT 1 cut(s) 9
Bme1390I CCNGG 2 cut(s) 209, 384
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 2 cut(s) 209, 384
BmsI GCATC 2 cut(s) 270, 279
BsaJI CCNNGG 2 cut(s) 48, 383
Bsc4I CCNNNNNNNGG 4 cut(s) 25, 232, 233, 378
BseBI CCWGG 2 cut(s) 209, 384
BseDI CCNNGG 2 cut(s) 48, 383
BseGI GGATG 2 cut(s) 247, 294
BseLI CCNNNNNNNGG 4 cut(s) 25, 232, 233, 378
BseMII CTCAG 1 cut(s) 161
BshFI GGCC 3 cut(s) 47, 225, 382
BsiSI CCGG 1 cut(s) 65
BslI CCNNNNNNNGG 4 cut(s) 25, 232, 233, 378
BsmI GAATGC 1 cut(s) 268
BsnI GGCC 3 cut(s) 47, 225, 382
Bsp143I GATC 4 cut(s) 9, 131, 154, 195
BspANI GGCC 3 cut(s) 47, 225, 382
BspCNI CTCAG 1 cut(s) 160
BspMI ACCTGC 1 cut(s) 232
BspPI GGATC 2 cut(s) 139, 162
BssECI CCNNGG 2 cut(s) 48, 383
BssMI GATC 4 cut(s) 9, 131, 154, 195
Bst2UI CCWGG 2 cut(s) 209, 384
BstAPI GCANNNNNTGC 1 cut(s) 289
BstC8I GCNNGC 3 cut(s) 70, 239, 326
BstDEI CTNAG 2 cut(s) 6, 147
BstF5I GGATG 2 cut(s) 247, 294
BstKTI GATC 4 cut(s) 12, 134, 157, 198
BstMBI GATC 4 cut(s) 9, 131, 154, 195
BstMWI GCNNNNNNNGC 2 cut(s) 280, 289
BstNI CCWGG 2 cut(s) 209, 384
BstNSI RCATGY 2 cut(s) 260, 328
BstSCI CCNGG 2 cut(s) 207, 382
BstX2I RGATCY 3 cut(s) 9, 131, 154
BstYI RGATCY 3 cut(s) 9, 131, 154
BsuRI GGCC 3 cut(s) 47, 225, 382
BtsCI GGATG 2 cut(s) 247, 294
BtsIMutI CAGTG 1 cut(s) 30
BveI ACCTGC 1 cut(s) 232
Cac8I GCNNGC 3 cut(s) 70, 239, 326
Cfr13I GGNCC 1 cut(s) 224
Csp6I GTAC 1 cut(s) 114
CviAII CATG 4 cut(s) 184, 257, 325, 378
CviQI GTAC 1 cut(s) 114
DdeI CTNAG 2 cut(s) 6, 147
DpnI GATC 4 cut(s) 11, 133, 156, 197
DpnII GATC 4 cut(s) 9, 131, 154, 195
EaeI YGGCCR 1 cut(s) 380
Eco57I CTGAAG 1 cut(s) 260
EcoRI GAATTC 1 cut(s) 200
EcoRII CCWGG 2 cut(s) 207, 382
FaeI CATG 4 cut(s) 187, 260, 328, 381
FaiI YATR 4 cut(s) 185, 258, 326, 379
FatI CATG 4 cut(s) 183, 256, 324, 377
FokI GGATG 2 cut(s) 234, 301
FspBI CTAG 1 cut(s) 39
HaeIII GGCC 3 cut(s) 47, 225, 382
HapII CCGG 1 cut(s) 65
Hin1II CATG 4 cut(s) 187, 260, 328, 381
HindIII AAGCTT 1 cut(s) 272
HpaII CCGG 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 57, 178
Hpy188I TCNGA 2 cut(s) 136, 279
Hpy8I GTNNAC 2 cut(s) 57, 178
HpyCH4V TGCA 6 cut(s) 72, 98, 241, 266, 283, 292
HpyF10VI GCNNNNNNNGC 2 cut(s) 280, 289
HpyF3I CTNAG 2 cut(s) 6, 147
Hsp92II CATG 4 cut(s) 187, 260, 328, 381
Kzo9I GATC 4 cut(s) 9, 131, 154, 195
LmnI GCTCC 2 cut(s) 301, 391
LpnPI CCDG 9 cut(s) 77, 78, 122, 137, 194, 221, 227, 305, 369
LweI GCATC 2 cut(s) 270, 279
MaeI CTAG 1 cut(s) 39
MalI GATC 4 cut(s) 11, 133, 156, 197
MboI GATC 4 cut(s) 9, 131, 154, 195
MfeI CAATTG 1 cut(s) 228
MflI RGATCY 3 cut(s) 9, 131, 154
MlsI TGGCCA 1 cut(s) 382
MluCI AATT 2 cut(s) 200, 228
MluNI TGGCCA 1 cut(s) 382
MnlI CCTC 4 cut(s) 58, 226, 261, 382
Mox20I TGGCCA 1 cut(s) 382
MscI TGGCCA 1 cut(s) 382
MslI CAYNNNNRTG 2 cut(s) 103, 261
Msp20I TGGCCA 1 cut(s) 382
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 209, 384
MunI CAATTG 1 cut(s) 228
Mva1269I GAATGC 1 cut(s) 268
MvaI CCWGG 2 cut(s) 209, 384
MwoI GCNNNNNNNGC 2 cut(s) 280, 289
NdeII GATC 4 cut(s) 9, 131, 154, 195
NlaIII CATG 4 cut(s) 187, 260, 328, 381
NspI RCATGY 2 cut(s) 260, 328
OliI CACNNNNGTG 1 cut(s) 103
PaeI GCATGC 1 cut(s) 328
PctI GAATGC 1 cut(s) 268
PflMI CCANNNNNTGG 2 cut(s) 25, 378
Psp6I CCWGG 2 cut(s) 207, 382
PspGI CCWGG 2 cut(s) 207, 382
PspPI GGNCC 1 cut(s) 224
PsuI RGATCY 3 cut(s) 9, 131, 154
RsaI GTAC 1 cut(s) 115
RsaNI GTAC 1 cut(s) 114
RseI CAYNNNNRTG 2 cut(s) 103, 261
Sau3AI GATC 4 cut(s) 9, 131, 154, 195
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 209, 384
SetI ASST 8 cut(s) 44, 78, 96, 174, 246, 276, 357, 396
SfaNI GCATC 2 cut(s) 270, 279
SmiMI CAYNNNNRTG 2 cut(s) 103, 261
SphI GCATGC 1 cut(s) 328
Sse9I AATT 2 cut(s) 200, 228
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 2 cut(s) 207, 382
TaqI TCGA 2 cut(s) 198, 253
TasI AATT 2 cut(s) 200, 228
TscAI CASTG 1 cut(s) 30
TspDTI ATGAA 2 cut(s) 200, 236
TspRI CASTG 1 cut(s) 30
Van91I CCANNNNNTGG 2 cut(s) 25, 378
XapI RAATTY 1 cut(s) 200
XceI RCATGY 2 cut(s) 260, 328
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.