Rorug02G0581400

LysM domain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
70519564 .. 70519991
428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0581400.1

Sequence Viewer

Length: 264 bp
ATGAAGAGAACCAAGGAACCTGGTGAGAACAAACTGCCTCCACCAGCACCTAACCAAACAGATAACAAAAAAAAGATGCCTAGAACCTACACCAAGATGACCTGCCAGGTGTGCTTCAAGAAAGGCCATAACAGGTTGGGCTGCCCAATCACTAAGGCCAAAAAACAACAGCAGCTCAACAAGCAGGTGAAGGGAGTTCCAATGGAGGCCAGCAAACTAGAAAGAGGCAAAGAAGGCAGTAGTAAATGTTTGATGGGTGAATGA

Protein Analysis

87

Amino Acids

9.8

Weight (kDa)

10.03

Isoelectric Point (pI)

52.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 175
Acc36I ACCTGC 2 cut(s) 110, 175
AgsI TTSAA 1 cut(s) 118
AjnI CCWGG 2 cut(s) 19, 105
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
AoxI GGCC 3 cut(s) 124, 156, 207
ApeKI GCWGC 2 cut(s) 141, 172
AsuHPI GGTGA 2 cut(s) 35, 199
BbvI GCAGC 2 cut(s) 128, 184
BccI CCATC 1 cut(s) 247
BciT130I CCWGG 2 cut(s) 21, 107
BfaI CTAG 2 cut(s) 81, 218
BfuAI ACCTGC 2 cut(s) 110, 175
BisI GCNGC 2 cut(s) 142, 173
BlsI GCNGC 2 cut(s) 143, 174
Bme1390I CCNGG 2 cut(s) 21, 107
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 2 cut(s) 21, 107
BmsI GCATC 1 cut(s) 66
BsaJI CCNNGG 1 cut(s) 12
BseBI CCWGG 2 cut(s) 21, 107
BseDI CCNNGG 1 cut(s) 12
BseXI GCAGC 2 cut(s) 128, 184
BshFI GGCC 3 cut(s) 126, 158, 209
BsnI GGCC 3 cut(s) 126, 158, 209
BspANI GGCC 3 cut(s) 126, 158, 209
BspLI GGNNCC 1 cut(s) 18
BspMI ACCTGC 2 cut(s) 110, 175
BssECI CCNNGG 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 2 cut(s) 21, 107
BstC8I GCNNGC 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 153
BstMWI GCNNNNNNNGC 3 cut(s) 111, 181, 234
BstNI CCWGG 2 cut(s) 21, 107
BstSCI CCNGG 2 cut(s) 19, 105
BstV1I GCAGC 2 cut(s) 128, 184
BsuRI GGCC 3 cut(s) 126, 158, 209
BveI ACCTGC 2 cut(s) 110, 175
Cac8I GCNNGC 1 cut(s) 211
CsiI ACCWGGT 1 cut(s) 19
CviJI RGCY 5 cut(s) 126, 141, 158, 175, 209
CviKI_1 RGCY 5 cut(s) 126, 141, 158, 175, 209
DdeI CTNAG 1 cut(s) 153
Eco130I CCWWGG 1 cut(s) 12
EcoRII CCWGG 2 cut(s) 19, 105
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaiI YATR 1 cut(s) 129
Fnu4HI GCNGC 2 cut(s) 142, 173
Fsp4HI GCNGC 2 cut(s) 142, 173
FspBI CTAG 2 cut(s) 81, 218
GluI GCNGC 2 cut(s) 142, 173
HaeIII GGCC 3 cut(s) 126, 158, 209
HphI GGTGA 2 cut(s) 35, 199
Hpy188III TCNNGA 1 cut(s) 118
HpyAV CCTTC 2 cut(s) 184, 227
HpyF10VI GCNNNNNNNGC 3 cut(s) 111, 181, 234
HpyF3I CTNAG 1 cut(s) 153
LpnPI CCDG 9 cut(s) 6, 33, 57, 92, 115, 118, 119, 170, 223
Lsp1109I GCAGC 2 cut(s) 128, 184
LweI GCATC 1 cut(s) 66
MabI ACCWGGT 1 cut(s) 19
MaeI CTAG 2 cut(s) 81, 218
MboII GAAGA 1 cut(s) 16
MnlI CCTC 3 cut(s) 48, 199, 218
MslI CAYNNNNRTG 1 cut(s) 95
MspR9I CCNGG 2 cut(s) 21, 107
MvaI CCWGG 2 cut(s) 21, 107
MwoI GCNNNNNNNGC 3 cut(s) 111, 181, 234
NlaIV GGNNCC 1 cut(s) 18
PaqCI CACCTGC 1 cut(s) 175
PkrI GCNGC 2 cut(s) 143, 174
Psp6I CCWGG 2 cut(s) 19, 105
PspGI CCWGG 2 cut(s) 19, 105
PspN4I GGNNCC 1 cut(s) 18
RseI CAYNNNNRTG 1 cut(s) 95
SatI GCNGC 2 cut(s) 142, 173
ScrFI CCNGG 2 cut(s) 21, 107
SetI ASST 8 cut(s) 22, 52, 89, 104, 111, 137, 177, 189
SexAI ACCWGGT 1 cut(s) 19
SfaNI GCATC 1 cut(s) 66
SmiMI CAYNNNNRTG 1 cut(s) 95
SspMI CTAG 2 cut(s) 81, 218
StyD4I CCNGG 2 cut(s) 19, 105
StyI CCWWGG 1 cut(s) 12
TseI GCWGC 2 cut(s) 141, 172
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 2 cut(s) 81, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.