Rorug03G0225600

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
20707996 .. 20710354
2359 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0225600.1

Sequence Viewer

Length: 198 bp
ATGTCAACAATGTGCACCGGCCAGCAGTTTCTACTTTGTAAAATTTCTTGGATCAAACGGTTGAATATCAAAGGTACAGGCCTCTACAGAGCAGAATGGCAAAAGAGGTTCAGATTGTCTGGTGATGGCGAAGAAAAGGCAAAGACATCTGGTGGCAAATCCCCTGCACAGGAAAAATACCCTGAGTGGTGTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.52

Weight (kDa)

9.51

Isoelectric Point (pI)

45.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013474)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 59
AcoI YGGCCR 1 cut(s) 19
AcsI RAATTY 1 cut(s) 42
AfaI GTAC 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 169
AgsI TTSAA 1 cut(s) 64
Alw21I GWGCWC 1 cut(s) 17
Alw44I GTGCAC 1 cut(s) 13
AlwI GGATC 1 cut(s) 59
AoxI GGCC 2 cut(s) 19, 79
ApaLI GTGCAC 1 cut(s) 13
ApoI RAATTY 1 cut(s) 42
AsuHPI GGTGA 1 cut(s) 134
BaeGI GKGCMC 1 cut(s) 17
Bbv12I GWGCWC 1 cut(s) 17
BccI CCATC 1 cut(s) 119
BfmI CTRYAG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 1 cut(s) 169
Bse118I RCCGGY 1 cut(s) 17
BseLI CCNNNNNNNGG 1 cut(s) 169
BseMII CTCAG 1 cut(s) 174
BseSI GKGCMC 1 cut(s) 17
BsgI GTGCAG 1 cut(s) 150
BshFI GGCC 2 cut(s) 21, 81
BsiHKAI GWGCWC 1 cut(s) 17
BsiSI CCGG 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 169
BsnI GGCC 2 cut(s) 21, 81
Bsp1286I GDGCHC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 51
BspANI GGCC 2 cut(s) 21, 81
BspCNI CTCAG 1 cut(s) 175
BspPI GGATC 1 cut(s) 59
BsrFI RCCGGY 1 cut(s) 17
BssAI RCCGGY 1 cut(s) 17
BssMI GATC 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 60
BstC8I GCNNGC 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 183
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstSFI CTRYAG 1 cut(s) 85
BstSLI GKGCMC 1 cut(s) 17
BsuRI GGCC 2 cut(s) 21, 81
Cac8I GCNNGC 1 cut(s) 23
Cfr10I RCCGGY 1 cut(s) 17
Csp6I GTAC 1 cut(s) 75
CviJI RGCY 2 cut(s) 21, 81
CviKI_1 RGCY 2 cut(s) 21, 81
CviQI GTAC 1 cut(s) 75
DdeI CTNAG 1 cut(s) 183
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
EaeI YGGCCR 1 cut(s) 19
Eco147I AGGCCT 1 cut(s) 81
HaeIII GGCC 2 cut(s) 21, 81
HapII CCGG 1 cut(s) 18
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HpaII CCGG 1 cut(s) 18
HphI GGTGA 1 cut(s) 134
Hpy166II GTNNAC 2 cut(s) 6, 15
Hpy188I TCNGA 1 cut(s) 113
Hpy8I GTNNAC 2 cut(s) 6, 15
HpyCH4III ACNGT 1 cut(s) 60
HpyCH4V TGCA 2 cut(s) 15, 167
HpyF3I CTNAG 1 cut(s) 183
Kzo9I GATC 1 cut(s) 51
LpnPI CCDG 7 cut(s) 31, 35, 63, 105, 135, 155, 177
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 1 cut(s) 143
MhlI GDGCHC 1 cut(s) 17
MluCI AATT 1 cut(s) 42
MnlI CCTC 2 cut(s) 92, 99
MspI CCGG 1 cut(s) 18
NdeII GATC 1 cut(s) 51
PceI AGGCCT 1 cut(s) 81
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
Sau3AI GATC 1 cut(s) 51
SduI GDGCHC 1 cut(s) 17
SetI ASST 2 cut(s) 76, 110
SfcI CTRYAG 1 cut(s) 85
SgeI CNNG 9 cut(s) 30, 34, 60, 90, 132, 162, 176, 182, 194
Sse9I AATT 1 cut(s) 42
SseBI AGGCCT 1 cut(s) 81
StuI AGGCCT 1 cut(s) 81
TaaI ACNGT 1 cut(s) 60
TasI AATT 1 cut(s) 42
VneI GTGCAC 1 cut(s) 13
XapI RAATTY 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.