Rorug04G0224500

Heparan-alpha-glucosaminide N-acetyltransferase-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
38545024 .. 38545191
168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0224500.1

Sequence Viewer

Length: 168 bp
ATGGTATTTTCACTACTAATAGCGCTTATTTTGTTGCAAATGATATTGCGCTTGGGATGGTTCTTGCTTCTCATGTGCCTCCTGATCCATTTCGGCCTCTCTAGAAGAAAATTTGGGGTGTTAAAGTTCCTGAAAAGTAGCTATACATGCTTGGAAGTGTTGCGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.47

Weight (kDa)

10.45

Isoelectric Point (pI)

52.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 110
AfeI AGCGCT 1 cut(s) 24
AluBI AGCT 1 cut(s) 141
AluI AGCT 1 cut(s) 141
AlwI GGATC 1 cut(s) 79
Aor51HI AGCGCT 1 cut(s) 24
AoxI GGCC 1 cut(s) 94
ApoI RAATTY 1 cut(s) 110
AspLEI GCGC 3 cut(s) 25, 51, 165
BccI CCATC 1 cut(s) 51
BfaI CTAG 2 cut(s) 102, 166
BfoI RGCGCY 1 cut(s) 26
BseGI GGATG 1 cut(s) 62
BshFI GGCC 1 cut(s) 96
BsnI GGCC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 84
BspANI GGCC 1 cut(s) 96
BspPI GGATC 1 cut(s) 79
BssMI GATC 1 cut(s) 84
BstF5I GGATG 1 cut(s) 62
BstH2I RGCGCY 1 cut(s) 26
BstHHI GCGC 3 cut(s) 25, 51, 165
BstKTI GATC 1 cut(s) 87
BstMBI GATC 1 cut(s) 84
BstMWI GCNNNNNNNGC 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 150
BsuRI GGCC 1 cut(s) 96
BtsCI GGATG 1 cut(s) 62
CfoI GCGC 3 cut(s) 25, 51, 165
CviAII CATG 2 cut(s) 73, 147
CviJI RGCY 2 cut(s) 96, 141
CviKI_1 RGCY 2 cut(s) 96, 141
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Eco47III AGCGCT 1 cut(s) 24
FaeI CATG 2 cut(s) 76, 150
FaiI YATR 3 cut(s) 74, 144, 148
FatI CATG 2 cut(s) 72, 146
FokI GGATG 1 cut(s) 69
FspBI CTAG 2 cut(s) 102, 166
GlaI GCGC 3 cut(s) 24, 50, 164
HaeII RGCGCY 1 cut(s) 26
HaeIII GGCC 1 cut(s) 96
HhaI GCGC 3 cut(s) 25, 51, 165
Hin1II CATG 2 cut(s) 76, 150
Hin6I GCGC 3 cut(s) 23, 49, 163
HinP1I GCGC 3 cut(s) 23, 49, 163
Hpy188III TCNNGA 3 cut(s) 82, 102, 130
HpyCH4V TGCA 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 1 cut(s) 147
Hsp92II CATG 2 cut(s) 76, 150
HspAI GCGC 3 cut(s) 23, 49, 163
Kzo9I GATC 1 cut(s) 84
LpnPI CCDG 2 cut(s) 95, 143
MaeI CTAG 2 cut(s) 102, 166
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 1 cut(s) 117
MluCI AATT 1 cut(s) 110
MnlI CCTC 2 cut(s) 89, 107
MseI TTAA 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 147
NdeII GATC 1 cut(s) 84
NlaIII CATG 2 cut(s) 76, 150
NspI RCATGY 1 cut(s) 150
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 1 cut(s) 84
SetI ASST 1 cut(s) 143
SgeI CNNG 8 cut(s) 64, 76, 85, 94, 114, 142, 159, 163
Sse9I AATT 1 cut(s) 110
SspMI CTAG 2 cut(s) 102, 166
TasI AATT 1 cut(s) 110
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
XapI RAATTY 1 cut(s) 110
XbaI TCTAGA 1 cut(s) 101
XceI RCATGY 1 cut(s) 150
XspI CTAG 2 cut(s) 102, 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.