Rorug04G0240900

Plant lipid transfer protein / seed storage protein / trypsin-alpha amylase inhibitor domain family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
40941180 .. 40942444
1265 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0240900.1

Sequence Viewer

Length: 279 bp
ATGCATAGACAGAATGTTCTTTATAGCAAGGCCGAGGCCTTATTCAATTTTGGATCAAAACCAATCATAAAAAGTCCATATGAAATTCCTATCTCATTTCCTGAGAGAACACATGTTGGATTATGCCCTAGCATCAGAATTACAGGTTGGGAAGTTTCAAAGTTTAGCTCTGGATTTCGTTTATTAAGAAGATCAGAGTGGCTGATGAAAATCAAGGAGAATTGTCTGATGAAGATGATGATCTGTGTCCAGTTGAATGTGTTAGAGAATTTTATCTGA

Protein Analysis

92

Amino Acids

10.78

Weight (kDa)

9.6

Isoelectric Point (pI)

45.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015442)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G27950
fragaria_vesca FvH4_4g23670
malus_domestica MD16G1120100.v1.1
prunus_persica Prupe.1G225100_v2.0.a1
pyrus_communis pycom13g10450 pycom16g10260
rosa_chinensis RchiOBHm_Chr4g0430161
rosa_laevigata RLG00000007000
rosa_multiflora Rmu_sc0004036.1_g000011
rosa_roxburghii Rroxscaffold_5G00371950
rosa_rugosa Rorug04G0240900
rosa_samantha Rh4AG297700 Rh4BG304100 Rh4CG319600 Rh4DG301500
rosa_wichuraiana Rw4G025810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 61
AcsI RAATTY 2 cut(s) 84, 268
AflIII ACRYGT 1 cut(s) 112
AgsI TTSAA 3 cut(s) 46, 159, 256
AjuI GAANNNNNNNTTGG 2 cut(s) 130, 162
AluBI AGCT 1 cut(s) 168
AluI AGCT 1 cut(s) 168
AlwI GGATC 1 cut(s) 61
AoxI GGCC 2 cut(s) 30, 36
ApoI RAATTY 2 cut(s) 84, 268
BfaI CTAG 1 cut(s) 129
BmsI GCATC 1 cut(s) 141
BsaBI GATNNNNATC 2 cut(s) 209, 239
BsaJI CCNNGG 1 cut(s) 33
Bse1I ACTGG 1 cut(s) 250
Bse8I GATNNNNATC 2 cut(s) 209, 239
BseDI CCNNGG 1 cut(s) 33
BseJI GATNNNNATC 2 cut(s) 209, 239
BseMII CTCAG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 250
BshFI GGCC 2 cut(s) 32, 38
BsnI GGCC 2 cut(s) 32, 38
Bsp143I GATC 3 cut(s) 53, 191, 240
BspANI GGCC 2 cut(s) 32, 38
BspCNI CTCAG 1 cut(s) 94
BspPI GGATC 1 cut(s) 61
BsrI ACTGG 1 cut(s) 250
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 3 cut(s) 53, 191, 240
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 3 cut(s) 56, 194, 243
BstMBI GATC 3 cut(s) 53, 191, 240
BstNSI RCATGY 1 cut(s) 116
BsuRI GGCC 2 cut(s) 32, 38
CviAII CATG 1 cut(s) 113
CviJI RGCY 4 cut(s) 32, 38, 168, 202
CviKI_1 RGCY 4 cut(s) 32, 38, 168, 202
DdeI CTNAG 1 cut(s) 102
DpnI GATC 3 cut(s) 55, 193, 242
DpnII GATC 3 cut(s) 53, 191, 240
Eco147I AGGCCT 1 cut(s) 38
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 116
FaiI YATR 7 cut(s) 6, 24, 68, 79, 81, 114, 124
FatI CATG 1 cut(s) 112
FauNDI CATATG 1 cut(s) 79
FspBI CTAG 1 cut(s) 129
HaeIII GGCC 2 cut(s) 32, 38
Hin1II CATG 1 cut(s) 116
Hpy188I TCNGA 4 cut(s) 137, 196, 228, 278
Hpy188III TCNNGA 2 cut(s) 101, 171
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 1 cut(s) 116
Kzo9I GATC 3 cut(s) 53, 191, 240
LpnPI CCDG 4 cut(s) 114, 129, 156, 263
LweI GCATC 1 cut(s) 141
MaeI CTAG 1 cut(s) 129
MalI GATC 3 cut(s) 55, 193, 242
MboI GATC 3 cut(s) 53, 191, 240
MboII GAAGA 2 cut(s) 201, 244
MluCI AATT 5 cut(s) 46, 84, 138, 220, 268
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 1 cut(s) 28
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 185
NdeI CATATG 1 cut(s) 79
NdeII GATC 3 cut(s) 53, 191, 240
NlaIII CATG 1 cut(s) 116
NmeAIII GCCGAG 1 cut(s) 58
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 116
PceI AGGCCT 1 cut(s) 38
PciI ACATGT 1 cut(s) 112
PscI ACATGT 1 cut(s) 112
SaqAI TTAA 1 cut(s) 185
Sau3AI GATC 3 cut(s) 53, 191, 240
SetI ASST 2 cut(s) 148, 170
SfaNI GCATC 1 cut(s) 141
SgeI CNNG 9 cut(s) 40, 46, 113, 125, 141, 156, 183, 226, 262
Sse9I AATT 5 cut(s) 46, 84, 138, 220, 268
SseBI AGGCCT 1 cut(s) 38
SspMI CTAG 1 cut(s) 129
StuI AGGCCT 1 cut(s) 38
TasI AATT 5 cut(s) 46, 84, 138, 220, 268
Tru1I TTAA 1 cut(s) 185
Tru9I TTAA 1 cut(s) 185
TspDTI ATGAA 3 cut(s) 96, 221, 245
XapI RAATTY 2 cut(s) 84, 268
XceI RCATGY 1 cut(s) 116
XspI CTAG 1 cut(s) 129
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.