Rorug04G0262600

Glutamate--glyoxylate aminotransferase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
43457024 .. 43457341
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0262600.1

Sequence Viewer

Length: 318 bp
ATGATACACAATCTGGAAAATGAATTGCTGGAAATGGAAAGAAAACTATTGGAGAAAGATATGTTGAATTCTCAAGAGAATTTTCTGAAAGATGATATAGAAAACAGTAACAGTGATGGTGAGGATGGTGAAGATGGTAAGGAAGAGGGTGGAGAAGGAGCTGATGGTGAAGATGGTGGAGACGATGATGAAGACAAAGAAGAAGAATCTGAAGTGAGAACAACCAGAAAGAAGCACACAACAGCAAGAAAAGATAAAAGAGCAGGTCTTCTCATAAACAGGAAGCAAAGAAACAATCAAGGAGAAGGGAAAGGGTGA

Protein Analysis

105

Amino Acids

11.86

Weight (kDa)

4.52

Isoelectric Point (pI)

36.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 254
AcsI RAATTY 2 cut(s) 67, 79
AcuI CTGAAG 1 cut(s) 231
AgsI TTSAA 1 cut(s) 67
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Alw26I GTCTC 1 cut(s) 174
ApoI RAATTY 2 cut(s) 67, 79
AsuHPI GGTGA 3 cut(s) 131, 140, 179
BbsI GAAGAC 2 cut(s) 198, 260
BccI CCATC 5 cut(s) 110, 119, 128, 158, 167
BcoDI GTCTC 1 cut(s) 174
BfuAI ACCTGC 1 cut(s) 254
BpiI GAAGAC 2 cut(s) 198, 260
BpuEI CTTGAG 1 cut(s) 57
BseGI GGATG 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 174
BsmBI CGTCTC 1 cut(s) 174
BspMI ACCTGC 1 cut(s) 254
Bst4CI ACNGT 2 cut(s) 107, 113
Bst6I CTCTTC 1 cut(s) 138
BstF5I GGATG 1 cut(s) 130
BstMAI GTCTC 1 cut(s) 174
BstV2I GAAGAC 2 cut(s) 198, 260
BtsCI GGATG 1 cut(s) 130
BtsIMutI CAGTG 1 cut(s) 118
BveI ACCTGC 1 cut(s) 254
CviJI RGCY 1 cut(s) 161
CviKI_1 RGCY 1 cut(s) 161
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco57I CTGAAG 1 cut(s) 231
EcoRI GAATTC 1 cut(s) 67
Esp3I CGTCTC 1 cut(s) 174
FaiI YATR 3 cut(s) 62, 98, 275
FokI GGATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 206
HphI GGTGA 3 cut(s) 131, 140, 179
Hpy188I TCNGA 2 cut(s) 87, 211
Hpy188III TCNNGA 2 cut(s) 14, 74
HpyAV CCTTC 2 cut(s) 149, 299
HpyCH4III ACNGT 2 cut(s) 107, 113
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 4 cut(s) 14, 238, 249, 265
MaeIII GTNAC 1 cut(s) 107
MboII GAAGA 7 cut(s) 143, 155, 182, 203, 212, 215, 260
MluCI AATT 3 cut(s) 23, 67, 79
MnlI CCTC 2 cut(s) 115, 139
PfeI GAWTC 1 cut(s) 206
SetI ASST 2 cut(s) 163, 268
SgeI CNNG 8 cut(s) 26, 41, 86, 237, 258, 276, 292, 311
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 3 cut(s) 23, 67, 79
TaaI ACNGT 2 cut(s) 107, 113
TasI AATT 3 cut(s) 23, 67, 79
TfiI GAWTC 1 cut(s) 206
TscAI CASTG 1 cut(s) 118
TspDTI ATGAA 2 cut(s) 36, 204
TspRI CASTG 1 cut(s) 118
XapI RAATTY 2 cut(s) 67, 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.