Rorug04G0411100

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
57368300 .. 57368476
177 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0411100.1

Sequence Viewer

Length: 177 bp
ATGCAATTTCGTAGAACTCATATTTTTAGGGAAGGGAATGCAGCTGCAGATAAGATGGCAAACTTAGGTGTTTCAAAACACTCATTTACCTGGTATCCTAGCCCTCCTGCAGAGCTTCACAGGTACTTGCAGGCGGATTTTTTGGGACTCCCAAATTATCGCTTCACAGGTTGCTGA

Protein Analysis

58

Amino Acids

6.72

Weight (kDa)

9.51

Isoelectric Point (pI)

45.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016280)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g02832
malus_domestica MD00G1101500.v1.1 MD10G1312400.v1.1
prunus_persica Prupe.4G028400_v2.0.a1
pyrus_communis pycom10g26370
rosa_chinensis RchiOBHm_Chr5g0004281
rosa_laevigata RLG00000031218
rosa_multiflora Rmu_co8460447.1_g000001
rosa_roxburghii Rroxscaffold_1G00071390
rosa_rugosa Rorug04G0411100
rosa_samantha Rh5BG037900 Rh5CG041600 Rh5DG037200
rosa_wichuraiana Rw5G003510 Rw5G003710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 134
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 1 cut(s) 75
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 2 cut(s) 44, 115
AluI AGCT 2 cut(s) 44, 115
ApeKI GCWGC 2 cut(s) 41, 44
BbvI GCAGC 2 cut(s) 31, 53
BccI CCATC 1 cut(s) 49
BciT130I CCWGG 1 cut(s) 91
BciVI GTATCC 1 cut(s) 105
BfaI CTAG 1 cut(s) 99
BfmI CTRYAG 2 cut(s) 45, 108
BfuI GTATCC 1 cut(s) 105
BisI GCNGC 2 cut(s) 42, 45
BlsI GCNGC 2 cut(s) 43, 46
Bme1390I CCNGG 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 91
BseXI GCAGC 2 cut(s) 31, 53
BslFI GGGAC 1 cut(s) 159
BsmFI GGGAC 1 cut(s) 159
BsmI GAATGC 1 cut(s) 43
BspACI CCGC 1 cut(s) 134
BspMAI CTGCAG 2 cut(s) 49, 112
Bst2UI CCWGG 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 64
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 89
BstSFI CTRYAG 2 cut(s) 45, 108
BstV1I GCAGC 2 cut(s) 31, 53
BsuI GTATCC 1 cut(s) 105
Cac8I GCNNGC 1 cut(s) 132
CsiI ACCWGGT 1 cut(s) 89
Csp6I GTAC 1 cut(s) 124
CviJI RGCY 3 cut(s) 44, 102, 115
CviKI_1 RGCY 3 cut(s) 44, 102, 115
CviQI GTAC 1 cut(s) 124
DdeI CTNAG 1 cut(s) 64
EciI GGCGGA 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 89
FaiI YATR 1 cut(s) 21
FaqI GGGAC 1 cut(s) 159
Fnu4HI GCNGC 2 cut(s) 42, 45
Fsp4HI GCNGC 2 cut(s) 42, 45
FspBI CTAG 1 cut(s) 99
GluI GCNGC 2 cut(s) 42, 45
HinfI GANTC 1 cut(s) 147
HpyAV CCTTC 1 cut(s) 26
HpyCH4V TGCA 5 cut(s) 4, 41, 47, 110, 130
HpyF3I CTNAG 1 cut(s) 64
LpnPI CCDG 6 cut(s) 76, 103, 106, 116, 120, 153
Lsp1109I GCAGC 2 cut(s) 31, 53
MabI ACCWGGT 1 cut(s) 89
MaeI CTAG 1 cut(s) 99
MluCI AATT 2 cut(s) 5, 154
MlyI GAGTC 1 cut(s) 141
MnlI CCTC 1 cut(s) 114
MspA1I CMGCKG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 91
Mva1269I GAATGC 1 cut(s) 43
MvaI CCWGG 1 cut(s) 91
PctI GAATGC 1 cut(s) 43
PkrI GCNGC 2 cut(s) 43, 46
PleI GAGTC 1 cut(s) 141
PpsI GAGTC 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PstI CTGCAG 2 cut(s) 49, 112
PvuII CAGCTG 1 cut(s) 44
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SatI GCNGC 2 cut(s) 42, 45
SchI GAGTC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 91
SetI ASST 6 cut(s) 46, 70, 92, 117, 125, 172
SexAI ACCWGGT 1 cut(s) 89
SfcI CTRYAG 2 cut(s) 45, 108
SgeI CNNG 7 cut(s) 102, 103, 111, 119, 133, 139, 143
Sse9I AATT 2 cut(s) 5, 154
SsiI CCGC 1 cut(s) 134
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 89
TasI AATT 2 cut(s) 5, 154
TseI GCWGC 2 cut(s) 41, 44
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.