Rorug07G0103100

Ribosomal protein S21

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0010416
Physical Location & Seq
Reverse (-)
8123789 .. 8124803
1015 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0103100.1

Sequence Viewer

Length: 378 bp
ATGGGAATGTCTTGCCTGCTCCCTAGAGGGGCACTTGCAGCACTGACGCGTTGCAAGCTTTTTCTTAATGAAAACAATCTTGCTGCAGTGGGTCCAGCTCCATCATTCTTGACGGTCAGGAAGGTTGTCATTGACTGCATTGTTAATGACATGAATCCAGAAACTTGTATGAGGAAGTTGACAACAGAATCCTTACAGATGCGTGCAAAGAAATATGGGGCGATTGAACTTCAACAAACAAATGTCGATGACATTGGAATGGAGAAGTGTGGCCCTTTTTTGGATTTATATGGCATGCTTGAAGTAACCTCTTATTCTTCATGCGTCGTAATAGGCCGAGAAAATGAGGTGCAAGAAGCTTGGCCGTTTGTGCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S21

Protein Analysis

125

Amino Acids

13.86

Weight (kDa)

5.37

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KH_KRR1_2nd PF21800 11 - 60 7.3e-06 KRR1 small subunit processome component, second KH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 49
AcoI YGGCCR 1 cut(s) 362
AfiI CCNNNNNNNGG 2 cut(s) 28, 280
AflIII ACRYGT 1 cut(s) 47
AgsI TTSAA 3 cut(s) 227, 233, 302
AluBI AGCT 3 cut(s) 58, 98, 359
AluI AGCT 3 cut(s) 58, 98, 359
Alw21I GWGCWC 1 cut(s) 375
Alw44I GTGCAC 1 cut(s) 371
AoxI GGCC 3 cut(s) 271, 334, 362
ApaLI GTGCAC 1 cut(s) 371
ApeKI GCWGC 2 cut(s) 38, 83
AspS9I GGNCC 2 cut(s) 92, 272
AvaII GGWCC 1 cut(s) 92
BaeGI GKGCMC 2 cut(s) 34, 375
Bbv12I GWGCWC 1 cut(s) 375
BbvI GCAGC 2 cut(s) 50, 70
BccI CCATC 1 cut(s) 109
BceAI ACGGC 1 cut(s) 349
BfaI CTAG 2 cut(s) 24, 376
BfmI CTRYAG 1 cut(s) 84
BisI GCNGC 2 cut(s) 39, 84
BlsI GCNGC 2 cut(s) 40, 85
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 2 cut(s) 92, 272
BmiI GGNNCC 1 cut(s) 93
BmsI GCATC 1 cut(s) 189
Bsc4I CCNNNNNNNGG 2 cut(s) 28, 280
BseLI CCNNNNNNNGG 2 cut(s) 28, 280
BseSI GKGCMC 2 cut(s) 34, 375
BseXI GCAGC 2 cut(s) 50, 70
Bsh1236I CGCG 1 cut(s) 49
BshFI GGCC 3 cut(s) 273, 336, 364
BsiHKAI GWGCWC 1 cut(s) 375
BslI CCNNNNNNNGG 2 cut(s) 28, 280
BsnI GGCC 3 cut(s) 273, 336, 364
Bsp1286I GDGCHC 2 cut(s) 34, 375
BspANI GGCC 3 cut(s) 273, 336, 364
BspFNI CGCG 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 93
BspMAI CTGCAG 1 cut(s) 88
Bst4CI ACNGT 1 cut(s) 115
BstC8I GCNNGC 4 cut(s) 17, 56, 204, 296
BstFNI CGCG 1 cut(s) 49
BstMWI GCNNNNNNNGC 3 cut(s) 38, 55, 370
BstNSI RCATGY 1 cut(s) 298
BstSFI CTRYAG 1 cut(s) 84
BstSLI GKGCMC 2 cut(s) 34, 375
BstUI CGCG 1 cut(s) 49
BstV1I GCAGC 2 cut(s) 50, 70
BsuRI GGCC 3 cut(s) 273, 336, 364
BtsI GCAGTG 1 cut(s) 93
BtsIMutI CAGTG 2 cut(s) 41, 93
Cac8I GCNNGC 4 cut(s) 17, 56, 204, 296
Cfr13I GGNCC 2 cut(s) 92, 272
CseI GACGC 2 cut(s) 55, 313
CviAII CATG 3 cut(s) 151, 295, 321
CviJI RGCY 6 cut(s) 58, 98, 273, 336, 359, 364
CviKI_1 RGCY 6 cut(s) 58, 98, 273, 336, 359, 364
EaeI YGGCCR 1 cut(s) 362
Eco47I GGWCC 1 cut(s) 92
FaeI CATG 3 cut(s) 154, 298, 324
FaiI YATR 7 cut(s) 152, 170, 216, 289, 291, 296, 322
FatI CATG 3 cut(s) 150, 294, 320
Fnu4HI GCNGC 2 cut(s) 39, 84
Fsp4HI GCNGC 2 cut(s) 39, 84
FspBI CTAG 2 cut(s) 24, 376
GluI GCNGC 2 cut(s) 39, 84
HaeIII GGCC 3 cut(s) 273, 336, 364
HgaI GACGC 2 cut(s) 55, 313
Hin1II CATG 3 cut(s) 154, 298, 324
HincII GTYRAC 1 cut(s) 180
HindII GTYRAC 1 cut(s) 180
HindIII AAGCTT 2 cut(s) 56, 357
HinfI GANTC 2 cut(s) 154, 188
Hpy166II GTNNAC 2 cut(s) 180, 373
Hpy188III TCNNGA 3 cut(s) 109, 118, 158
Hpy8I GTNNAC 2 cut(s) 180, 373
Hpy99I CGWCG 1 cut(s) 329
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 7 cut(s) 38, 54, 86, 138, 206, 352, 373
HpyF10VI GCNNNNNNNGC 3 cut(s) 38, 55, 370
Hsp92II CATG 3 cut(s) 154, 298, 324
LmnI GCTCC 2 cut(s) 24, 103
LpnPI CCDG 4 cut(s) 29, 103, 108, 171
Lsp1109I GCAGC 2 cut(s) 50, 70
LweI GCATC 1 cut(s) 189
MaeI CTAG 2 cut(s) 24, 376
MaeIII GTNAC 1 cut(s) 304
MboII GAAGA 1 cut(s) 309
MhlI GDGCHC 2 cut(s) 34, 375
MluI ACGCGT 1 cut(s) 47
MnlI CCTC 4 cut(s) 20, 165, 319, 340
MseI TTAA 2 cut(s) 66, 144
MslI CAYNNNNRTG 1 cut(s) 257
MvnI CGCG 1 cut(s) 49
MwoI GCNNNNNNNGC 3 cut(s) 38, 55, 370
NlaIII CATG 3 cut(s) 154, 298, 324
NlaIV GGNNCC 1 cut(s) 93
NmeAIII GCCGAG 1 cut(s) 362
NspI RCATGY 1 cut(s) 298
PaeI GCATGC 1 cut(s) 298
PfeI GAWTC 2 cut(s) 154, 188
PkrI GCNGC 2 cut(s) 40, 85
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 2 cut(s) 92, 272
PstI CTGCAG 1 cut(s) 88
RseI CAYNNNNRTG 1 cut(s) 257
SaqAI TTAA 2 cut(s) 66, 144
SatI GCNGC 2 cut(s) 39, 84
Sau96I GGNCC 2 cut(s) 92, 272
SduI GDGCHC 2 cut(s) 34, 375
SetI ASST 6 cut(s) 60, 100, 126, 311, 351, 361
SfaNI GCATC 1 cut(s) 189
SfcI CTRYAG 1 cut(s) 84
SinI GGWCC 1 cut(s) 92
SmiMI CAYNNNNRTG 1 cut(s) 257
SphI GCATGC 1 cut(s) 298
SspMI CTAG 2 cut(s) 24, 376
TaaI ACNGT 1 cut(s) 115
TaqI TCGA 1 cut(s) 246
TfiI GAWTC 2 cut(s) 154, 188
Tru1I TTAA 2 cut(s) 66, 144
Tru9I TTAA 2 cut(s) 66, 144
TscAI CASTG 2 cut(s) 48, 93
TseI GCWGC 2 cut(s) 38, 83
TspDTI ATGAA 3 cut(s) 84, 167, 309
TspRI CASTG 2 cut(s) 48, 93
VneI GTGCAC 1 cut(s) 371
VpaK11BI GGWCC 1 cut(s) 92
XceI RCATGY 1 cut(s) 298
XspI CTAG 2 cut(s) 24, 376
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.