Rh1AG006000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
816743 .. 820179
3437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG006000.1

Sequence Viewer

Length: 195 bp
ATGGACTCGATTGGTGATGGGACGTCACAGACTCCAACTCAGTCTAGCATCGGAACTACACCAGCTTCGGCTGAAGTCGGACAACTCCTCATAAAGGACCTAAAGTTGAGAGAAGAGAAGGGGAAGAAAGGAGAAGCTGATCTGGGAACCAGACACGCTGAGTTTGGTATAGAAAAGAAAGAAGACAAAACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

6.83

Weight (kDa)

5.28

Isoelectric Point (pI)

30.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 26
AcuI CTGAAG 1 cut(s) 93
AcyI GRCGYC 1 cut(s) 23
AfiI CCNNNNNNNGG 1 cut(s) 94
AluBI AGCT 2 cut(s) 65, 137
AluI AGCT 2 cut(s) 65, 137
AspS9I GGNCC 1 cut(s) 97
AsuHPI GGTGA 1 cut(s) 26
AvaII GGWCC 1 cut(s) 97
BbsI GAAGAC 1 cut(s) 189
BccI CCATC 1 cut(s) 11
BfaI CTAG 1 cut(s) 45
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 148
BmsI GCATC 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 189
BsaHI GRCGYC 1 cut(s) 23
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMII CTCAG 2 cut(s) 53, 150
BseRI GAGGAG 1 cut(s) 77
BslFI GGGAC 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 94
BsmFI GGGAC 1 cut(s) 34
Bsp143I GATC 1 cut(s) 139
BspCNI CTCAG 2 cut(s) 52, 151
BspLI GGNNCC 1 cut(s) 148
BssMI GATC 1 cut(s) 139
BssNI GRCGYC 1 cut(s) 23
Bst6I CTCTTC 1 cut(s) 108
BstACI GRCGYC 1 cut(s) 23
BstDEI CTNAG 2 cut(s) 39, 159
BstENI CCTNNNNNAGG 1 cut(s) 92
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstV2I GAAGAC 1 cut(s) 189
Cfr13I GGNCC 1 cut(s) 97
CviJI RGCY 3 cut(s) 65, 71, 137
CviKI_1 RGCY 3 cut(s) 65, 71, 137
DdeI CTNAG 2 cut(s) 39, 159
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
Eco47I GGWCC 1 cut(s) 97
Eco57I CTGAAG 1 cut(s) 93
EcoNI CCTNNNNNAGG 1 cut(s) 92
EcoO109I RGGNCCY 1 cut(s) 97
FaiI YATR 2 cut(s) 92, 170
FaqI GGGAC 1 cut(s) 34
FspBI CTAG 1 cut(s) 45
Hin1I GRCGYC 1 cut(s) 23
HinfI GANTC 2 cut(s) 5, 31
HphI GGTGA 1 cut(s) 26
Hpy188I TCNGA 2 cut(s) 53, 80
HpyAV CCTTC 1 cut(s) 112
HpyCH4IV ACGT 2 cut(s) 23, 191
HpyF3I CTNAG 2 cut(s) 39, 159
HpySE526I ACGT 2 cut(s) 23, 191
Hsp92I GRCGYC 1 cut(s) 23
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 3 cut(s) 75, 128, 163
LweI GCATC 1 cut(s) 57
MaeI CTAG 1 cut(s) 45
MaeII ACGT 2 cut(s) 23, 191
MaeIII GTNAC 1 cut(s) 24
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 3 cut(s) 125, 136, 194
MlyI GAGTC 1 cut(s) 25
MmeI TCCRAC 2 cut(s) 58, 59
MnlI CCTC 1 cut(s) 98
NdeII GATC 1 cut(s) 139
NlaIV GGNNCC 1 cut(s) 148
NmuCI GTSAC 1 cut(s) 24
PleI GAGTC 1 cut(s) 25
PpsI GAGTC 1 cut(s) 25
PpuMI RGGWCCY 1 cut(s) 97
Psp5II RGGWCCY 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 148
PspPI GGNCC 1 cut(s) 97
PspPPI RGGWCCY 1 cut(s) 97
Sau3AI GATC 1 cut(s) 139
Sau96I GGNCC 1 cut(s) 97
SchI GAGTC 1 cut(s) 25
SetI ASST 5 cut(s) 26, 67, 102, 139, 194
SfaNI GCATC 1 cut(s) 57
SgeI CNNG 6 cut(s) 19, 57, 74, 155, 162, 167
SinI GGWCC 1 cut(s) 97
SspMI CTAG 1 cut(s) 45
TaiI ACGT 2 cut(s) 26, 194
TaqI TCGA 1 cut(s) 8
TseFI GTSAC 1 cut(s) 24
Tsp45I GTSAC 1 cut(s) 24
VpaK11BI GGWCC 1 cut(s) 97
XagI CCTNNNNNAGG 1 cut(s) 92
XspI CTAG 1 cut(s) 45
ZraI GACGTC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.