Rh1CG023900

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0013300
Physical Location & Seq
Forward (+)
4376758 .. 4394570
17813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG023900.1

Sequence Viewer

Length: 213 bp
ATGGTGGTGGATATATCCATCCTTAATAAGAATCTGGACCTGAGACTGATATTAAACATGAAGAGAGTCTTAACAACTCAGACTTCCTTACTTTCTAGAGCTGATGCTAAAGTGAAGGAGTTGCGACATTCAATTGATGTTCTAAAGGCTGAAAAAAAAGTCTTCTCGTTTTTCTCGGGCTGTCTCGGATCCTCCTTTTCCATATCTCCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.82

Weight (kDa)

9.9

Isoelectric Point (pI)

37.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7903 PF25475 1 - 28 1.7e-07 Domain of unknown function (DUF7903)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013300)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G45060
fragaria_vesca FvH4_7g10760 FvH4_7g10760
malus_domestica MD07G1087600.v1.1
prunus_persica Prupe.2G135800_v2.0.a1
pyrus_communis pycom07g07010
rosa_chinensis RchiOBHm_Chr1g0348701
rosa_laevigata RLG00000028629
rosa_multiflora Rmu_sc0001674.1_g000007
rosa_roxburghii Rroxscaffold_4G00306730
rosa_rugosa Rorug01G0196800
rosa_samantha Rh1AG025500 Rh1AG214300 Rh1BG180900 Rh1CG023900 Rh1CG199000 Rh1DG210900
rosa_wichuraiana Rw1G018160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 183, 196
AgsI TTSAA 1 cut(s) 132
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw26I GTCTC 2 cut(s) 37, 188
AlwI GGATC 2 cut(s) 183, 196
Ama87I CYCGRG 1 cut(s) 175
AspS9I GGNCC 1 cut(s) 37
AvaI CYCGRG 1 cut(s) 175
AvaII GGWCC 1 cut(s) 37
BamHI GGATCC 1 cut(s) 188
BbsI GAAGAC 1 cut(s) 154
BccI CCATC 1 cut(s) 26
BcoDI GTCTC 2 cut(s) 37, 188
BfaI CTAG 1 cut(s) 96
Bme18I GGWCC 1 cut(s) 37
BmeT110I CYCGRG 1 cut(s) 175
BmgT120I GGNCC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 190
BmsI GCATC 1 cut(s) 94
BpiI GAAGAC 1 cut(s) 154
BseGI GGATG 1 cut(s) 18
BseMII CTCAG 2 cut(s) 32, 92
BsiHKCI CYCGRG 1 cut(s) 175
BsmAI GTCTC 2 cut(s) 37, 188
BsoBI CYCGRG 1 cut(s) 175
Bsp143I GATC 1 cut(s) 188
BspCNI CTCAG 2 cut(s) 33, 91
BspLI GGNNCC 1 cut(s) 190
BspPI GGATC 2 cut(s) 183, 196
BssMI GATC 1 cut(s) 188
Bst6I CTCTTC 1 cut(s) 56
BstDEI CTNAG 2 cut(s) 41, 78
BstF5I GGATG 1 cut(s) 18
BstKTI GATC 1 cut(s) 191
BstMAI GTCTC 2 cut(s) 37, 188
BstMBI GATC 1 cut(s) 188
BstV2I GAAGAC 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 188
BstYI RGATCY 1 cut(s) 188
BtsCI GGATG 1 cut(s) 18
Cfr13I GGNCC 1 cut(s) 37
CviAII CATG 1 cut(s) 58
CviJI RGCY 3 cut(s) 101, 149, 180
CviKI_1 RGCY 3 cut(s) 101, 149, 180
DdeI CTNAG 2 cut(s) 41, 78
DpnI GATC 1 cut(s) 190
DpnII GATC 1 cut(s) 188
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
Eco47I GGWCC 1 cut(s) 37
Eco88I CYCGRG 1 cut(s) 175
FaeI CATG 1 cut(s) 61
FaiI YATR 3 cut(s) 14, 59, 203
FalI AAGNNNNNCTT 2 cut(s) 53, 85
FatI CATG 1 cut(s) 57
FokI GGATG 1 cut(s) 5
FspBI CTAG 1 cut(s) 96
Hin1II CATG 1 cut(s) 61
HinfI GANTC 2 cut(s) 31, 66
Hpy188I TCNGA 2 cut(s) 81, 188
Hpy188III TCNNGA 2 cut(s) 35, 96
HpyAV CCTTC 1 cut(s) 109
HpyF3I CTNAG 2 cut(s) 41, 78
Hsp92II CATG 1 cut(s) 61
Kzo9I GATC 1 cut(s) 188
LpnPI CCDG 2 cut(s) 20, 53
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 96
MalI GATC 1 cut(s) 190
MboI GATC 1 cut(s) 188
MboII GAAGA 2 cut(s) 73, 154
MfeI CAATTG 1 cut(s) 132
MflI RGATCY 1 cut(s) 188
MluCI AATT 1 cut(s) 132
MlyI GAGTC 1 cut(s) 75
MnlI CCTC 1 cut(s) 202
MseI TTAA 3 cut(s) 24, 53, 71
MunI CAATTG 1 cut(s) 132
NdeII GATC 1 cut(s) 188
NlaIII CATG 1 cut(s) 61
NlaIV GGNNCC 1 cut(s) 190
PfeI GAWTC 1 cut(s) 31
PleI GAGTC 1 cut(s) 74
PpsI GAGTC 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 190
PspPI GGNCC 1 cut(s) 37
PsuI RGATCY 1 cut(s) 188
SaqAI TTAA 3 cut(s) 24, 53, 71
Sau3AI GATC 1 cut(s) 188
Sau96I GGNCC 1 cut(s) 37
SchI GAGTC 1 cut(s) 75
SetI ASST 2 cut(s) 42, 103
SfaNI GCATC 1 cut(s) 94
SgeI CNNG 8 cut(s) 47, 52, 70, 108, 178, 187, 189, 197
SinI GGWCC 1 cut(s) 37
Sse9I AATT 1 cut(s) 132
SspMI CTAG 1 cut(s) 96
TasI AATT 1 cut(s) 132
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 3 cut(s) 24, 53, 71
Tru9I TTAA 3 cut(s) 24, 53, 71
TspDTI ATGAA 1 cut(s) 74
TspGWI ACGGA 1 cut(s) 198
VpaK11BI GGWCC 1 cut(s) 37
XbaI TCTAGA 1 cut(s) 95
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.