Rh2AG057900

Alpha/beta hydrolase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
4688818 .. 4690662
1845 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG057900.1

Sequence Viewer

Length: 861 bp
ATGTTAGAAACTAAGAGCCTTTCATCAGCCATGAACGCTAAAATCGTGGGCACGGGGAGTGAGTCCATAGTCTTAGCACATGGCTATGGGGGAGACCAGTCTGTGTGGGACAAAATCCTTCCCTACTTGGCTCAACATTACAGTGTTCTTGTTTTCGACTGGACCTTTTCGGGTGCTGCTAAGGACCCCAACCTCTTTGATCCTGCCAAATATTCGAGCTACGATGATTTTGCTCATGACTTGATTGCTCTATTGGATGAACTTAACTTGAAATCCTCAGTCTATATTGGCCACTCCATGTCTGGTATGGTTGGATGCATTGCCTCCATCAAGAGACCTGACCTCTTTAGCAGCCTCATACTTCTTGGAGCTTCTCCTAGGTATATGAATACAGATGACTATGAAGGTGGGTTTGGGAGTTCAGACATTAAACAAATCCTCTCAAGCATAGAATCCAACTTTCACAACTGGGCTGCTCACTTTGCTCCCCTTGTTGTGGACTCAAATGACCCTCTCTCTGTTGACAAGTTTACCAAGTGCCTGCAAAAAATGAGACCTGAATTTGCACTTGCTGTAGGAAAAATCGTCTTTTACAGCGACGAAAGAGACACTCTCGACAAGGTCTCAACTCCATGCACTATCATCCACACCAGCAGTGACATTGTCTCTCCAAAATCGGTCGCGTTTTACATGCAAAAGAAAATCAAGGAAAACCCCAAAGTGGAGATTATGAATACTAATGGCCATTTCCCACAGTTGACTGCACACATTCAGCTTCTTGATGTGCTAGGACTCATCTTGGGGGTTGAATTGGATCTTGATCTTGATCTTAAACCAAGATTGGGCAAATTATCATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

286

Amino Acids

31.5

Weight (kDa)

5.42

Isoelectric Point (pI)

34.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Hydrolase_4 PF12146 22 - 236 1.1e-08 Serine aminopeptidase, S33
Abhydrolase_1 PF00561 23 - 254 5.5e-17 alpha/beta hydrolase fold
Abhydrolase_6 PF12697 23 - 254 4.8e-14 Alpha/beta hydrolase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014310)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G24420
fragaria_vesca FvH4_1g05320
malus_domestica MD02G1056400.v1.1 MD15G1189400.v1.1
prunus_persica Prupe.7G227500_v2.0.a1
pyrus_communis pycom02g04550 pycom15g16980
rosa_chinensis RchiOBHm_Chr2g0091021
rosa_laevigata RLG00000016167
rosa_multiflora Rmu_sc0003305.1_g000006
rosa_roxburghii Rroxscaffold_2G00150680
rosa_rugosa Rorug02G0011500
rosa_samantha Rh2AG057900 Rh2BG056200 Rh2CG058500 Rh2DG057600
rosa_wichuraiana Rw2G005140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 683
AclWI GGATC 2 cut(s) 194, 822
AcoI YGGCCR 2 cut(s) 289, 742
AcsI RAATTY 1 cut(s) 560
AfiI CCNNNNNNNGG 3 cut(s) 496, 721, 842
AgsI TTSAA 2 cut(s) 271, 809
AjuI GAANNNNNNNTTGG 2 cut(s) 396, 428
AluBI AGCT 3 cut(s) 219, 371, 775
AluI AGCT 3 cut(s) 219, 371, 775
Alw26I GTCTC 6 cut(s) 87, 328, 547, 600, 628, 670
AlwI GGATC 2 cut(s) 194, 822
AoxI GGCC 2 cut(s) 289, 742
ApeKI GCWGC 3 cut(s) 176, 351, 473
ApoI RAATTY 1 cut(s) 560
AspA2I CCTAGG 1 cut(s) 377
AspS9I GGNCC 2 cut(s) 162, 184
AvaII GGWCC 2 cut(s) 162, 184
AvrII CCTAGG 1 cut(s) 377
BaeGI GKGCMC 1 cut(s) 53
BalI TGGCCA 2 cut(s) 291, 744
BbvI GCAGC 3 cut(s) 163, 363, 460
BccI CCATC 1 cut(s) 335
BcgI CGANNNNNNTGC 2 cut(s) 212, 246
BcoDI GTCTC 6 cut(s) 87, 328, 547, 600, 628, 670
BfaI CTAG 2 cut(s) 378, 788
BfmI CTRYAG 1 cut(s) 573
BisI GCNGC 3 cut(s) 177, 352, 474
BlnI CCTAGG 1 cut(s) 377
BlsI GCNGC 3 cut(s) 178, 353, 475
Bme18I GGWCC 2 cut(s) 162, 184
BmgT120I GGNCC 2 cut(s) 162, 184
BmiI GGNNCC 1 cut(s) 186
BmrI ACTGGG 1 cut(s) 478
BmsI GCATC 1 cut(s) 305
BmuI ACTGGG 1 cut(s) 478
BplI GAGNNNNNCTC 2 cut(s) 597, 629
Bpu10I CCTNAGC 1 cut(s) 180
BpuEI CTTGAG 1 cut(s) 427
BsaBI GATNNNNATC 2 cut(s) 819, 825
BsaI GGTCTC 4 cut(s) 87, 328, 547, 628
BsaJI CCNNGG 1 cut(s) 377
Bsc4I CCNNNNNNNGG 3 cut(s) 496, 721, 842
Bse1I ACTGG 3 cut(s) 97, 164, 473
Bse3DI GCAATG 1 cut(s) 318
Bse8I GATNNNNATC 2 cut(s) 819, 825
BseDI CCNNGG 1 cut(s) 377
BseGI GGATG 3 cut(s) 262, 320, 642
BseJI GATNNNNATC 2 cut(s) 819, 825
BseLI CCNNNNNNNGG 3 cut(s) 496, 721, 842
BseMI GCAATG 1 cut(s) 318
BseMII CTCAG 1 cut(s) 291
BseNI ACTGG 3 cut(s) 97, 164, 473
BseSI GKGCMC 1 cut(s) 53
BseXI GCAGC 3 cut(s) 163, 363, 460
BsgI GTGCAG 1 cut(s) 747
Bsh1236I CGCG 1 cut(s) 683
Bsh1285I CGRYCG 1 cut(s) 681
BshFI GGCC 2 cut(s) 291, 744
BsiEI CGRYCG 1 cut(s) 681
BslFI GGGAC 1 cut(s) 122
BslI CCNNNNNNNGG 3 cut(s) 496, 721, 842
BsmAI GTCTC 6 cut(s) 87, 328, 547, 600, 628, 670
BsmFI GGGAC 1 cut(s) 122
BsnI GGCC 2 cut(s) 291, 744
Bso31I GGTCTC 4 cut(s) 87, 328, 547, 628
Bsp1286I GDGCHC 1 cut(s) 53
Bsp143I GATC 4 cut(s) 199, 814, 820, 826
BspANI GGCC 2 cut(s) 291, 744
BspCNI CTCAG 1 cut(s) 290
BspFNI CGCG 1 cut(s) 683
BspHI TCATGA 1 cut(s) 235
BspLI GGNNCC 1 cut(s) 186
BspPI GGATC 2 cut(s) 194, 822
BspTNI GGTCTC 4 cut(s) 87, 328, 547, 628
BsrDI GCAATG 1 cut(s) 318
BsrI ACTGG 3 cut(s) 97, 164, 473
BssECI CCNNGG 1 cut(s) 377
BssMI GATC 4 cut(s) 199, 814, 820, 826
BssT1I CCWWGG 1 cut(s) 377
Bst4CI ACNGT 2 cut(s) 143, 756
BstC8I GCNNGC 1 cut(s) 542
BstDEI CTNAG 4 cut(s) 12, 73, 180, 277
BstF5I GGATG 3 cut(s) 262, 320, 642
BstFNI CGCG 1 cut(s) 683
BstKTI GATC 4 cut(s) 202, 817, 823, 829
BstMAI GTCTC 6 cut(s) 87, 328, 547, 600, 628, 670
BstMBI GATC 4 cut(s) 199, 814, 820, 826
BstMCI CGRYCG 1 cut(s) 681
BstMWI GCNNNNNNNGC 2 cut(s) 35, 482
BstNSI RCATGY 1 cut(s) 694
BstSFI CTRYAG 1 cut(s) 573
BstSLI GKGCMC 1 cut(s) 53
BstUI CGCG 1 cut(s) 683
BstV1I GCAGC 3 cut(s) 163, 363, 460
BstX2I RGATCY 1 cut(s) 814
BstYI RGATCY 1 cut(s) 814
BsuRI GGCC 2 cut(s) 291, 744
BtsCI GGATG 3 cut(s) 262, 320, 642
BtsI GCAGTG 1 cut(s) 661
BtsIMutI CAGTG 2 cut(s) 148, 661
Cac8I GCNNGC 1 cut(s) 542
CciI TCATGA 1 cut(s) 235
Cfr13I GGNCC 2 cut(s) 162, 184
CviAII CATG 7 cut(s) 31, 80, 236, 298, 633, 691, 855
DdeI CTNAG 4 cut(s) 12, 73, 180, 277
DpnI GATC 4 cut(s) 201, 816, 822, 828
DpnII GATC 4 cut(s) 199, 814, 820, 826
EaeI YGGCCR 2 cut(s) 289, 742
Eco130I CCWWGG 1 cut(s) 377
Eco31I GGTCTC 4 cut(s) 87, 328, 547, 628
Eco47I GGWCC 2 cut(s) 162, 184
EcoO109I RGGNCCY 1 cut(s) 184
EcoT14I CCWWGG 1 cut(s) 377
EcoT22I ATGCAT 1 cut(s) 320
ErhI CCWWGG 1 cut(s) 377
FaeI CATG 7 cut(s) 34, 83, 239, 301, 636, 694, 858
FaqI GGGAC 1 cut(s) 122
FatI CATG 7 cut(s) 30, 79, 235, 297, 632, 690, 854
Fnu4HI GCNGC 3 cut(s) 177, 352, 474
FokI GGATG 3 cut(s) 269, 327, 629
Fsp4HI GCNGC 3 cut(s) 177, 352, 474
FspBI CTAG 2 cut(s) 378, 788
GluI GCNGC 3 cut(s) 177, 352, 474
HaeIII GGCC 2 cut(s) 291, 744
Hin1II CATG 7 cut(s) 34, 83, 239, 301, 636, 694, 858
HincII GTYRAC 2 cut(s) 523, 759
HindII GTYRAC 2 cut(s) 523, 759
HinfI GANTC 4 cut(s) 62, 452, 500, 792
Hpy166II GTNNAC 4 cut(s) 499, 523, 531, 759
Hpy188I TCNGA 1 cut(s) 424
Hpy188III TCNNGA 6 cut(s) 236, 331, 614, 779, 818, 824
Hpy8I GTNNAC 4 cut(s) 499, 523, 531, 759
Hpy99I CGWCG 1 cut(s) 602
HpyAV CCTTC 2 cut(s) 128, 398
HpyCH4III ACNGT 2 cut(s) 143, 756
HpyCH4V TGCA 6 cut(s) 318, 544, 566, 636, 694, 764
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 482
HpyF3I CTNAG 4 cut(s) 12, 73, 180, 277
Hsp92II CATG 7 cut(s) 34, 83, 239, 301, 636, 694, 858
Kzo9I GATC 4 cut(s) 199, 814, 820, 826
LmnI GCTCC 2 cut(s) 368, 490
LpnPI CCDG 9 cut(s) 110, 145, 216, 288, 351, 454, 554, 570, 664
Lsp1109I GCAGC 3 cut(s) 163, 363, 460
LweI GCATC 1 cut(s) 305
MaeI CTAG 2 cut(s) 378, 788
MaeIII GTNAC 1 cut(s) 656
MalI GATC 4 cut(s) 201, 816, 822, 828
MboI GATC 4 cut(s) 199, 814, 820, 826
MflI RGATCY 1 cut(s) 814
MhlI GDGCHC 1 cut(s) 53
MlsI TGGCCA 2 cut(s) 291, 744
MluCI AATT 3 cut(s) 560, 809, 848
MluNI TGGCCA 2 cut(s) 291, 744
MlyI GAGTC 3 cut(s) 71, 494, 786
MmeI TCCRAC 2 cut(s) 292, 480
MnlI CCTC 7 cut(s) 203, 286, 334, 353, 365, 449, 522
Mox20I TGGCCA 2 cut(s) 291, 744
Mph1103I ATGCAT 1 cut(s) 320
MscI TGGCCA 2 cut(s) 291, 744
MseI TTAA 3 cut(s) 264, 429, 831
MslI CAYNNNNRTG 2 cut(s) 84, 141
Msp20I TGGCCA 2 cut(s) 291, 744
MvnI CGCG 1 cut(s) 683
MwoI GCNNNNNNNGC 2 cut(s) 35, 482
NdeII GATC 4 cut(s) 199, 814, 820, 826
NlaIII CATG 7 cut(s) 34, 83, 239, 301, 636, 694, 858
NlaIV GGNNCC 1 cut(s) 186
NmuCI GTSAC 1 cut(s) 656
NsiI ATGCAT 1 cut(s) 320
NspI RCATGY 1 cut(s) 694
PagI TCATGA 1 cut(s) 235
PcsI WCGNNNNNNNCGW 1 cut(s) 42
PfeI GAWTC 1 cut(s) 452
PflFI GACNNNGTC 2 cut(s) 620, 662
PkrI GCNGC 3 cut(s) 178, 353, 475
PleI GAGTC 3 cut(s) 70, 494, 786
PpsI GAGTC 3 cut(s) 70, 494, 786
PpuMI RGGWCCY 1 cut(s) 184
Psp5II RGGWCCY 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 186
PspPI GGNCC 2 cut(s) 162, 184
PspPPI RGGWCCY 1 cut(s) 184
PsuI RGATCY 1 cut(s) 814
PsyI GACNNNGTC 2 cut(s) 620, 662
RseI CAYNNNNRTG 2 cut(s) 84, 141
SaqAI TTAA 3 cut(s) 264, 429, 831
SatI GCNGC 3 cut(s) 177, 352, 474
Sau3AI GATC 4 cut(s) 199, 814, 820, 826
Sau96I GGNCC 2 cut(s) 162, 184
SchI GAGTC 3 cut(s) 71, 494, 786
SduI GDGCHC 1 cut(s) 53
SfaNI GCATC 1 cut(s) 305
SfcI CTRYAG 1 cut(s) 573
SinI GGWCC 2 cut(s) 162, 184
SmiMI CAYNNNNRTG 2 cut(s) 84, 141
SmlI CTYRAG 1 cut(s) 442
SmoI CTYRAG 1 cut(s) 442
Sse9I AATT 3 cut(s) 560, 809, 848
SspI AATATT 1 cut(s) 212
SspMI CTAG 2 cut(s) 378, 788
StyI CCWWGG 1 cut(s) 377
TaaI ACNGT 2 cut(s) 143, 756
TaqI TCGA 3 cut(s) 156, 215, 615
TaqII GACCGA 1 cut(s) 667
TasI AATT 3 cut(s) 560, 809, 848
TfiI GAWTC 1 cut(s) 452
Tru1I TTAA 3 cut(s) 264, 429, 831
Tru9I TTAA 3 cut(s) 264, 429, 831
TscAI CASTG 2 cut(s) 148, 661
TseFI GTSAC 1 cut(s) 656
TseI GCWGC 3 cut(s) 176, 351, 473
Tsp45I GTSAC 1 cut(s) 656
TspDTI ATGAA 6 cut(s) 12, 47, 273, 401, 417, 746
TspRI CASTG 2 cut(s) 148, 661
Tth111I GACNNNGTC 2 cut(s) 620, 662
VpaK11BI GGWCC 2 cut(s) 162, 184
XapI RAATTY 1 cut(s) 560
XceI RCATGY 1 cut(s) 694
XcmI CCANNNNNNNNNTGG 2 cut(s) 299, 304
XmaJI CCTAGG 1 cut(s) 377
XspI CTAG 2 cut(s) 378, 788
Zsp2I ATGCAT 1 cut(s) 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.