Rh2DG057600

Alpha/beta hydrolase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
4237764 .. 4239603
1840 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG057600.1

Sequence Viewer

Length: 864 bp
ATGGTGTTAGAAACTAAGAGCCTTTCATCAGCCATGAACGCTAAAATCGTGGGCACGGGGAGTGAGTCCATAGTCTTAGCACATGGCTATGGGGGAGACCAGTCTGTGTGGGACAAAATCCTTCCCTACTTGGCTCAACATTACAGTGTTCTTGTTTTCGACTGGACCTTTTCGGGTGCTGCTAAGGACCCCAACCTCTTTGATCCTGCCAAATATTCGAGCTACGATGATTTTGCTCATGACTTGATTGCTCTATTGGATGAACTTAACTTGAAATCCTCAGTCTATGTTGGCCACTCCATGTCTGGTATGGTTGGATGCATTGCTTCCATCAAGAGACCTGACCTCTTTAGCAGCCTCATACTTCTTGGAGCTTCTCCTAGGTATATGAATACAGATGACTATGAAGGTGGGTTTGGGAGTTCAGACATTAAACAAATCCTCTCAAGCATAGAATCCAACTTTCACAACTGGGCTGCTCACTTTGCTCCCCTTGCTGTGGACTCAAATGACCCTCTCTCTGTTGACAAGTTTACCAAGTGCCTGCAAAAAATGAGACCTGAATTTGCACTTGCTGTAGGAAAAATCGTCTTTTACAGCGACGAAAGAGACACTCTCGACAAGGTCTCAACTCCATGCACTATCATCCACACCAGCAGTGACATTGTCTCTCCAAAATCGGTCGCGTTTTACATGCAAAAGAAAATCAAGGAAAACCCCAAAGTGGAGATTATGAATACTAATGGCCATTTCCCACAGTTGACTGCACACATTCAGCTTCTTGATGTGCTAGGACTCATCTTGGGGGTTGAATTGGATCTTGATCTTGATCTTAAACCAAGATTGGGCAAATTATCATGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

287

Amino Acids

31.56

Weight (kDa)

5.42

Isoelectric Point (pI)

33.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Hydrolase_4 PF12146 23 - 237 9.6e-09 Serine aminopeptidase, S33
Abhydrolase_1 PF00561 24 - 130 7e-16 alpha/beta hydrolase fold
Abhydrolase_6 PF12697 24 - 255 2.6e-14 Alpha/beta hydrolase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014310)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G24420
fragaria_vesca FvH4_1g05320
malus_domestica MD02G1056400.v1.1 MD15G1189400.v1.1
prunus_persica Prupe.7G227500_v2.0.a1
pyrus_communis pycom02g04550 pycom15g16980
rosa_chinensis RchiOBHm_Chr2g0091021
rosa_laevigata RLG00000016167
rosa_multiflora Rmu_sc0003305.1_g000006
rosa_roxburghii Rroxscaffold_2G00150680
rosa_rugosa Rorug02G0011500
rosa_samantha Rh2AG057900 Rh2BG056200 Rh2CG058500 Rh2DG057600
rosa_wichuraiana Rw2G005140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 686
AclWI GGATC 2 cut(s) 197, 825
AcoI YGGCCR 2 cut(s) 292, 745
AcsI RAATTY 1 cut(s) 563
AfiI CCNNNNNNNGG 3 cut(s) 499, 724, 845
AgsI TTSAA 2 cut(s) 274, 812
AjuI GAANNNNNNNTTGG 2 cut(s) 399, 431
AluBI AGCT 3 cut(s) 222, 374, 778
AluI AGCT 3 cut(s) 222, 374, 778
Alw26I GTCTC 6 cut(s) 90, 331, 550, 603, 631, 673
AlwI GGATC 2 cut(s) 197, 825
AoxI GGCC 2 cut(s) 292, 745
ApeKI GCWGC 3 cut(s) 179, 354, 476
ApoI RAATTY 1 cut(s) 563
AspA2I CCTAGG 1 cut(s) 380
AspS9I GGNCC 2 cut(s) 165, 187
AvaII GGWCC 2 cut(s) 165, 187
AvrII CCTAGG 1 cut(s) 380
BaeGI GKGCMC 1 cut(s) 56
BalI TGGCCA 2 cut(s) 294, 747
BbvI GCAGC 3 cut(s) 166, 366, 463
BccI CCATC 1 cut(s) 338
BcgI CGANNNNNNTGC 2 cut(s) 215, 249
BcoDI GTCTC 6 cut(s) 90, 331, 550, 603, 631, 673
BfaI CTAG 2 cut(s) 381, 791
BfmI CTRYAG 1 cut(s) 576
BisI GCNGC 3 cut(s) 180, 355, 477
BlnI CCTAGG 1 cut(s) 380
BlsI GCNGC 3 cut(s) 181, 356, 478
Bme18I GGWCC 2 cut(s) 165, 187
BmgT120I GGNCC 2 cut(s) 165, 187
BmiI GGNNCC 1 cut(s) 189
BmrI ACTGGG 1 cut(s) 481
BmsI GCATC 1 cut(s) 308
BmuI ACTGGG 1 cut(s) 481
BplI GAGNNNNNCTC 2 cut(s) 600, 632
Bpu10I CCTNAGC 1 cut(s) 183
BpuEI CTTGAG 1 cut(s) 430
BsaBI GATNNNNATC 2 cut(s) 822, 828
BsaI GGTCTC 4 cut(s) 90, 331, 550, 631
BsaJI CCNNGG 1 cut(s) 380
Bsc4I CCNNNNNNNGG 3 cut(s) 499, 724, 845
Bse1I ACTGG 3 cut(s) 100, 167, 476
Bse3DI GCAATG 1 cut(s) 321
Bse8I GATNNNNATC 2 cut(s) 822, 828
BseDI CCNNGG 1 cut(s) 380
BseGI GGATG 3 cut(s) 265, 323, 645
BseJI GATNNNNATC 2 cut(s) 822, 828
BseLI CCNNNNNNNGG 3 cut(s) 499, 724, 845
BseMI GCAATG 1 cut(s) 321
BseMII CTCAG 1 cut(s) 294
BseNI ACTGG 3 cut(s) 100, 167, 476
BseSI GKGCMC 1 cut(s) 56
BseXI GCAGC 3 cut(s) 166, 366, 463
BsgI GTGCAG 1 cut(s) 750
Bsh1236I CGCG 1 cut(s) 686
Bsh1285I CGRYCG 1 cut(s) 684
BshFI GGCC 2 cut(s) 294, 747
BsiEI CGRYCG 1 cut(s) 684
BslFI GGGAC 1 cut(s) 125
BslI CCNNNNNNNGG 3 cut(s) 499, 724, 845
BsmAI GTCTC 6 cut(s) 90, 331, 550, 603, 631, 673
BsmFI GGGAC 1 cut(s) 125
BsnI GGCC 2 cut(s) 294, 747
Bso31I GGTCTC 4 cut(s) 90, 331, 550, 631
Bsp1286I GDGCHC 1 cut(s) 56
Bsp143I GATC 4 cut(s) 202, 817, 823, 829
BspANI GGCC 2 cut(s) 294, 747
BspCNI CTCAG 1 cut(s) 293
BspFNI CGCG 1 cut(s) 686
BspHI TCATGA 1 cut(s) 238
BspLI GGNNCC 1 cut(s) 189
BspPI GGATC 2 cut(s) 197, 825
BspTNI GGTCTC 4 cut(s) 90, 331, 550, 631
BsrDI GCAATG 1 cut(s) 321
BsrI ACTGG 3 cut(s) 100, 167, 476
BssECI CCNNGG 1 cut(s) 380
BssMI GATC 4 cut(s) 202, 817, 823, 829
BssT1I CCWWGG 1 cut(s) 380
Bst4CI ACNGT 2 cut(s) 146, 759
BstC8I GCNNGC 1 cut(s) 545
BstDEI CTNAG 4 cut(s) 15, 76, 183, 280
BstF5I GGATG 3 cut(s) 265, 323, 645
BstFNI CGCG 1 cut(s) 686
BstKTI GATC 4 cut(s) 205, 820, 826, 832
BstMAI GTCTC 6 cut(s) 90, 331, 550, 603, 631, 673
BstMBI GATC 4 cut(s) 202, 817, 823, 829
BstMCI CGRYCG 1 cut(s) 684
BstMWI GCNNNNNNNGC 3 cut(s) 38, 485, 494
BstNSI RCATGY 1 cut(s) 697
BstSFI CTRYAG 1 cut(s) 576
BstSLI GKGCMC 1 cut(s) 56
BstUI CGCG 1 cut(s) 686
BstV1I GCAGC 3 cut(s) 166, 366, 463
BstX2I RGATCY 1 cut(s) 817
BstYI RGATCY 1 cut(s) 817
BsuRI GGCC 2 cut(s) 294, 747
BtsCI GGATG 3 cut(s) 265, 323, 645
BtsI GCAGTG 1 cut(s) 664
BtsIMutI CAGTG 2 cut(s) 151, 664
Cac8I GCNNGC 1 cut(s) 545
CciI TCATGA 1 cut(s) 238
Cfr13I GGNCC 2 cut(s) 165, 187
CviAII CATG 7 cut(s) 34, 83, 239, 301, 636, 694, 858
DdeI CTNAG 4 cut(s) 15, 76, 183, 280
DpnI GATC 4 cut(s) 204, 819, 825, 831
DpnII GATC 4 cut(s) 202, 817, 823, 829
EaeI YGGCCR 2 cut(s) 292, 745
Eco130I CCWWGG 1 cut(s) 380
Eco31I GGTCTC 4 cut(s) 90, 331, 550, 631
Eco47I GGWCC 2 cut(s) 165, 187
EcoO109I RGGNCCY 1 cut(s) 187
EcoT14I CCWWGG 1 cut(s) 380
EcoT22I ATGCAT 1 cut(s) 323
ErhI CCWWGG 1 cut(s) 380
FaeI CATG 7 cut(s) 37, 86, 242, 304, 639, 697, 861
FaqI GGGAC 1 cut(s) 125
FatI CATG 7 cut(s) 33, 82, 238, 300, 635, 693, 857
Fnu4HI GCNGC 3 cut(s) 180, 355, 477
FokI GGATG 3 cut(s) 272, 330, 632
Fsp4HI GCNGC 3 cut(s) 180, 355, 477
FspBI CTAG 2 cut(s) 381, 791
GluI GCNGC 3 cut(s) 180, 355, 477
HaeIII GGCC 2 cut(s) 294, 747
Hin1II CATG 7 cut(s) 37, 86, 242, 304, 639, 697, 861
HincII GTYRAC 2 cut(s) 526, 762
HindII GTYRAC 2 cut(s) 526, 762
HinfI GANTC 4 cut(s) 65, 455, 503, 795
Hpy166II GTNNAC 4 cut(s) 502, 526, 534, 762
Hpy188I TCNGA 1 cut(s) 427
Hpy188III TCNNGA 6 cut(s) 239, 334, 617, 782, 821, 827
Hpy8I GTNNAC 4 cut(s) 502, 526, 534, 762
Hpy99I CGWCG 1 cut(s) 605
HpyAV CCTTC 2 cut(s) 131, 401
HpyCH4III ACNGT 2 cut(s) 146, 759
HpyCH4V TGCA 6 cut(s) 321, 547, 569, 639, 697, 767
HpyF10VI GCNNNNNNNGC 3 cut(s) 38, 485, 494
HpyF3I CTNAG 4 cut(s) 15, 76, 183, 280
Hsp92II CATG 7 cut(s) 37, 86, 242, 304, 639, 697, 861
Kzo9I GATC 4 cut(s) 202, 817, 823, 829
LmnI GCTCC 2 cut(s) 371, 493
LpnPI CCDG 9 cut(s) 113, 148, 219, 291, 354, 457, 557, 573, 667
Lsp1109I GCAGC 3 cut(s) 166, 366, 463
LweI GCATC 1 cut(s) 308
MaeI CTAG 2 cut(s) 381, 791
MaeIII GTNAC 1 cut(s) 659
MalI GATC 4 cut(s) 204, 819, 825, 831
MboI GATC 4 cut(s) 202, 817, 823, 829
MflI RGATCY 1 cut(s) 817
MhlI GDGCHC 1 cut(s) 56
MlsI TGGCCA 2 cut(s) 294, 747
MluCI AATT 3 cut(s) 563, 812, 851
MluNI TGGCCA 2 cut(s) 294, 747
MlyI GAGTC 3 cut(s) 74, 497, 789
MmeI TCCRAC 2 cut(s) 295, 483
MnlI CCTC 6 cut(s) 206, 289, 356, 368, 452, 525
Mox20I TGGCCA 2 cut(s) 294, 747
Mph1103I ATGCAT 1 cut(s) 323
MscI TGGCCA 2 cut(s) 294, 747
MseI TTAA 3 cut(s) 267, 432, 834
MslI CAYNNNNRTG 2 cut(s) 87, 144
Msp20I TGGCCA 2 cut(s) 294, 747
MvnI CGCG 1 cut(s) 686
MwoI GCNNNNNNNGC 3 cut(s) 38, 485, 494
NdeII GATC 4 cut(s) 202, 817, 823, 829
NlaIII CATG 7 cut(s) 37, 86, 242, 304, 639, 697, 861
NlaIV GGNNCC 1 cut(s) 189
NmuCI GTSAC 1 cut(s) 659
NsiI ATGCAT 1 cut(s) 323
NspI RCATGY 1 cut(s) 697
PagI TCATGA 1 cut(s) 238
PcsI WCGNNNNNNNCGW 1 cut(s) 45
PfeI GAWTC 1 cut(s) 455
PflFI GACNNNGTC 2 cut(s) 623, 665
PkrI GCNGC 3 cut(s) 181, 356, 478
PleI GAGTC 3 cut(s) 73, 497, 789
PpsI GAGTC 3 cut(s) 73, 497, 789
PpuMI RGGWCCY 1 cut(s) 187
Psp5II RGGWCCY 1 cut(s) 187
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 2 cut(s) 165, 187
PspPPI RGGWCCY 1 cut(s) 187
PsuI RGATCY 1 cut(s) 817
PsyI GACNNNGTC 2 cut(s) 623, 665
RseI CAYNNNNRTG 2 cut(s) 87, 144
SaqAI TTAA 3 cut(s) 267, 432, 834
SatI GCNGC 3 cut(s) 180, 355, 477
Sau3AI GATC 4 cut(s) 202, 817, 823, 829
Sau96I GGNCC 2 cut(s) 165, 187
SchI GAGTC 3 cut(s) 74, 497, 789
SduI GDGCHC 1 cut(s) 56
SfaNI GCATC 1 cut(s) 308
SfcI CTRYAG 1 cut(s) 576
SinI GGWCC 2 cut(s) 165, 187
SmiMI CAYNNNNRTG 2 cut(s) 87, 144
SmlI CTYRAG 1 cut(s) 445
SmoI CTYRAG 1 cut(s) 445
Sse9I AATT 3 cut(s) 563, 812, 851
SspI AATATT 1 cut(s) 215
SspMI CTAG 2 cut(s) 381, 791
StyI CCWWGG 1 cut(s) 380
TaaI ACNGT 2 cut(s) 146, 759
TaqI TCGA 3 cut(s) 159, 218, 618
TaqII GACCGA 1 cut(s) 670
TasI AATT 3 cut(s) 563, 812, 851
TfiI GAWTC 1 cut(s) 455
Tru1I TTAA 3 cut(s) 267, 432, 834
Tru9I TTAA 3 cut(s) 267, 432, 834
TscAI CASTG 2 cut(s) 151, 664
TseFI GTSAC 1 cut(s) 659
TseI GCWGC 3 cut(s) 179, 354, 476
Tsp45I GTSAC 1 cut(s) 659
TspDTI ATGAA 6 cut(s) 15, 50, 276, 404, 420, 749
TspRI CASTG 2 cut(s) 151, 664
Tth111I GACNNNGTC 2 cut(s) 623, 665
VpaK11BI GGWCC 2 cut(s) 165, 187
XapI RAATTY 1 cut(s) 563
XceI RCATGY 1 cut(s) 697
XcmI CCANNNNNNNNNTGG 2 cut(s) 302, 307
XmaJI CCTAGG 1 cut(s) 380
XspI CTAG 2 cut(s) 381, 791
Zsp2I ATGCAT 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.