Rh2CG477100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
64257867 .. 64259974
2108 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG477100.1

Sequence Viewer

Length: 444 bp
ATGCTTAGACTAAATTCAGATTATGCTGACTTCATTCTAAACACATCTGATATGCCTGCTGTTACAGGATCTTCATCGTCTGCTCAAACACGTCTGGATCTTTTGGAGCAACTTACCTCAACTAGCTCATCAGTTGACGGAGGTTATGAGAGTGATGCTAGCTCCCAAAAACTTACGATCCGTGAGCAACTAGCACAGTTGTTTGCGGATAGAGATGGTGATTTCACAATTCCACTGGGTAAAAAGTTCAAAAAGGTGAGTCCCAAGGTTTTAACTATCTCACAGAAGCGGAACATCAGAAGACAGGCTTACTTAAATGAAGTATCTCAGAGGAATGATTCAACTTTCTTTGCCACCATTGGAGCATTTGTACTTGTTCCACCTCTTGTAATATTAGGAATTGCTATAGCAACAGGCTATGTACAGCTGAGTTTCCTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.11

Weight (kDa)

7.96

Isoelectric Point (pI)

43.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012983)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 206, 289
AclWI GGATC 3 cut(s) 76, 105, 172
AcsI RAATTY 1 cut(s) 13
AfaI GTAC 2 cut(s) 372, 423
AflIII ACRYGT 1 cut(s) 89
AgsI TTSAA 2 cut(s) 250, 342
AjiI CACGTC 1 cut(s) 92
AluBI AGCT 3 cut(s) 126, 162, 427
AluI AGCT 3 cut(s) 126, 162, 427
AlwI GGATC 3 cut(s) 76, 105, 172
ApoI RAATTY 1 cut(s) 13
AsuHPI GGTGA 2 cut(s) 230, 268
AsuNHI GCTAGC 1 cut(s) 158
BbsI GAAGAC 1 cut(s) 307
BccI CCATC 1 cut(s) 209
BfaI CTAG 3 cut(s) 123, 159, 191
BfmI CTRYAG 1 cut(s) 405
BmgBI CACGTC 1 cut(s) 92
BmrI ACTGGG 1 cut(s) 245
BmsI GCATC 1 cut(s) 145
BmtI GCTAGC 1 cut(s) 162
BmuI ACTGGG 1 cut(s) 245
BpiI GAAGAC 1 cut(s) 307
BsaBI GATNNNNATC 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 264
BsaXI ACNNNNNCTCC 2 cut(s) 354, 384
Bse1I ACTGG 1 cut(s) 240
Bse8I GATNNNNATC 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 264
BseJI GATNNNNATC 1 cut(s) 73
BseMII CTCAG 2 cut(s) 341, 419
BseNI ACTGG 1 cut(s) 240
BslFI GGGAC 1 cut(s) 246
BsmFI GGGAC 1 cut(s) 246
Bsp1407I TGTACA 1 cut(s) 421
Bsp143I GATC 3 cut(s) 68, 97, 177
BspACI CCGC 2 cut(s) 206, 289
BspCNI CTCAG 2 cut(s) 340, 420
BspOI GCTAGC 1 cut(s) 162
BspPI GGATC 3 cut(s) 76, 105, 172
BsrGI TGTACA 1 cut(s) 421
BsrI ACTGG 1 cut(s) 240
BssECI CCNNGG 1 cut(s) 264
BssMI GATC 3 cut(s) 68, 97, 177
BssT1I CCWWGG 1 cut(s) 264
Bst4CI ACNGT 1 cut(s) 198
BstAUI TGTACA 1 cut(s) 421
BstC8I GCNNGC 2 cut(s) 57, 160
BstDEI CTNAG 3 cut(s) 5, 327, 428
BstKTI GATC 3 cut(s) 71, 100, 180
BstMBI GATC 3 cut(s) 68, 97, 177
BstSFI CTRYAG 1 cut(s) 405
BstV2I GAAGAC 1 cut(s) 307
BstX2I RGATCY 2 cut(s) 68, 97
BstYI RGATCY 2 cut(s) 68, 97
BtrI CACGTC 1 cut(s) 92
BtsIMutI CAGTG 1 cut(s) 233
Cac8I GCNNGC 2 cut(s) 57, 160
Csp6I GTAC 2 cut(s) 371, 422
CviJI RGCY 5 cut(s) 126, 162, 308, 417, 427
CviKI_1 RGCY 5 cut(s) 126, 162, 308, 417, 427
CviQI GTAC 2 cut(s) 371, 422
DdeI CTNAG 3 cut(s) 5, 327, 428
DpnI GATC 3 cut(s) 70, 99, 179
DpnII GATC 3 cut(s) 68, 97, 177
Eco130I CCWWGG 1 cut(s) 264
EcoT14I CCWWGG 1 cut(s) 264
ErhI CCWWGG 1 cut(s) 264
FaiI YATR 5 cut(s) 24, 53, 147, 407, 420
FalI AAGNNNNNCTT 2 cut(s) 292, 324
FaqI GGGAC 1 cut(s) 246
FspBI CTAG 3 cut(s) 123, 159, 191
HincII GTYRAC 1 cut(s) 136
HindII GTYRAC 1 cut(s) 136
HinfI GANTC 2 cut(s) 259, 338
HphI GGTGA 2 cut(s) 230, 268
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 4 cut(s) 19, 49, 299, 330
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 136
HpyCH4III ACNGT 1 cut(s) 198
HpyCH4IV ACGT 1 cut(s) 91
HpyF3I CTNAG 3 cut(s) 5, 327, 428
HpySE526I ACGT 1 cut(s) 91
Kzo9I GATC 3 cut(s) 68, 97, 177
LmnI GCTCC 3 cut(s) 106, 167, 362
LpnPI CCDG 6 cut(s) 51, 69, 80, 221, 290, 399
LweI GCATC 1 cut(s) 145
MaeI CTAG 3 cut(s) 123, 159, 191
MaeII ACGT 1 cut(s) 91
MaeIII GTNAC 1 cut(s) 61
MalI GATC 3 cut(s) 70, 99, 179
MboI GATC 3 cut(s) 68, 97, 177
MboII GAAGA 2 cut(s) 63, 312
MflI RGATCY 2 cut(s) 68, 97
MluCI AATT 4 cut(s) 13, 228, 399, 439
MlyI GAGTC 1 cut(s) 268
MnlI CCTC 4 cut(s) 127, 134, 324, 393
MseI TTAA 4 cut(s) 272, 314, 438, 442
MspA1I CMGCKG 1 cut(s) 427
NdeII GATC 3 cut(s) 68, 97, 177
NheI GCTAGC 1 cut(s) 158
PacI TTAATTAA 1 cut(s) 442
PfeI GAWTC 1 cut(s) 338
PleI GAGTC 1 cut(s) 267
PpsI GAGTC 1 cut(s) 267
PsuI RGATCY 2 cut(s) 68, 97
PvuII CAGCTG 1 cut(s) 427
RsaI GTAC 2 cut(s) 372, 423
RsaNI GTAC 2 cut(s) 371, 422
SaqAI TTAA 4 cut(s) 272, 314, 438, 442
Sau3AI GATC 3 cut(s) 68, 97, 177
SchI GAGTC 1 cut(s) 268
SetI ASST 9 cut(s) 94, 119, 128, 145, 164, 258, 270, 385, 429
SfaNI GCATC 1 cut(s) 145
SfcI CTRYAG 1 cut(s) 405
Sse9I AATT 4 cut(s) 13, 228, 399, 439
SsiI CCGC 2 cut(s) 206, 289
SspI AATATT 1 cut(s) 393
SspMI CTAG 3 cut(s) 123, 159, 191
StyI CCWWGG 1 cut(s) 264
TaaI ACNGT 1 cut(s) 198
TaiI ACGT 1 cut(s) 94
TasI AATT 4 cut(s) 13, 228, 399, 439
TatI WGTACW 2 cut(s) 370, 421
TfiI GAWTC 1 cut(s) 338
Tru1I TTAA 4 cut(s) 272, 314, 438, 442
Tru9I TTAA 4 cut(s) 272, 314, 438, 442
TscAI CASTG 1 cut(s) 240
TspDTI ATGAA 3 cut(s) 22, 63, 333
TspGWI ACGGA 2 cut(s) 153, 170
TspRI CASTG 1 cut(s) 240
XapI RAATTY 1 cut(s) 13
XspI CTAG 3 cut(s) 123, 159, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.