Rh3CG154800

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
12956905 .. 12957873
969 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG154800.1

Sequence Viewer

Length: 264 bp
ATGAACCTTGAAGAAATTGTTACAAACTATCCATATCGGAAGAACTTGCCTAAGGAAGACATGATTAAAGGGGCCTTGTTGAGTTTGATCCTTCAAAACGCTGGTCACCTTTTCAGGTTGTTAAATTTTCACCACGCTTCAGAACACCCTTTTGTTACAAGGGAACCTTTTACTTGCCCTTATCAACCTCCATCAAAGCCTCCTCGCATGATTCCAGGCAGAAACAGGGTCACCATGCTTAGCAACCCACATTTTCAGGATTGA

Protein Analysis

87

Amino Acids

10.15

Weight (kDa)

9.36

Isoelectric Point (pI)

34.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 82
AcsI RAATTY 1 cut(s) 124
AcuI CTGAAG 1 cut(s) 123
AgsI TTSAA 2 cut(s) 11, 95
AjnI CCWGG 1 cut(s) 214
AlwI GGATC 1 cut(s) 82
AoxI GGCC 1 cut(s) 72
ApoI RAATTY 1 cut(s) 124
ArsI GACNNNNNNTTYG 2 cut(s) 88, 120
AspS9I GGNCC 1 cut(s) 72
AsuHPI GGTGA 3 cut(s) 98, 122, 223
AxyI CCTNAGG 1 cut(s) 51
BbsI GAAGAC 1 cut(s) 63
BccI CCATC 1 cut(s) 199
BciT130I CCWGG 1 cut(s) 216
BlpI GCTNAGC 1 cut(s) 239
Bme1390I CCNGG 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 72
BmiI GGNNCC 2 cut(s) 73, 165
BmrFI CCNGG 1 cut(s) 216
BpiI GAAGAC 1 cut(s) 63
Bpu1102I GCTNAGC 1 cut(s) 239
Bse21I CCTNAGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 216
BseRI GAGGAG 1 cut(s) 192
BshFI GGCC 1 cut(s) 74
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 87
Bsp1720I GCTNAGC 1 cut(s) 239
BspANI GGCC 1 cut(s) 74
BspLI GGNNCC 2 cut(s) 73, 165
BspPI GGATC 1 cut(s) 82
BssMI GATC 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 216
BstDEI CTNAG 2 cut(s) 51, 239
BstEII GGTNACC 2 cut(s) 104, 229
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstNI CCWGG 1 cut(s) 216
BstPI GGTNACC 2 cut(s) 104, 229
BstSCI CCNGG 1 cut(s) 214
BstV2I GAAGAC 1 cut(s) 63
Bsu36I CCTNAGG 1 cut(s) 51
BsuRI GGCC 1 cut(s) 74
Cfr13I GGNCC 1 cut(s) 72
CviAII CATG 3 cut(s) 61, 208, 235
CviJI RGCY 2 cut(s) 74, 199
CviKI_1 RGCY 2 cut(s) 74, 199
DdeI CTNAG 2 cut(s) 51, 239
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
Eco57I CTGAAG 1 cut(s) 123
Eco81I CCTNAGG 1 cut(s) 51
Eco91I GGTNACC 2 cut(s) 104, 229
EcoO109I RGGNCCY 1 cut(s) 72
EcoO65I GGTNACC 2 cut(s) 104, 229
EcoRII CCWGG 1 cut(s) 214
FaeI CATG 3 cut(s) 64, 211, 238
FaiI YATR 4 cut(s) 34, 62, 209, 236
FalI AAGNNNNNCTT 2 cut(s) 151, 183
FatI CATG 3 cut(s) 60, 207, 234
HaeIII GGCC 1 cut(s) 74
Hin1II CATG 3 cut(s) 64, 211, 238
HinfI GANTC 1 cut(s) 211
HphI GGTGA 3 cut(s) 98, 122, 223
Hpy188I TCNGA 2 cut(s) 39, 142
Hpy188III TCNNGA 1 cut(s) 257
HpyAV CCTTC 1 cut(s) 101
HpyF3I CTNAG 2 cut(s) 51, 239
Hsp92II CATG 3 cut(s) 64, 211, 238
Kzo9I GATC 1 cut(s) 87
LpnPI CCDG 6 cut(s) 87, 100, 201, 211, 228, 242
MaeIII GTNAC 4 cut(s) 19, 104, 154, 229
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 3 cut(s) 23, 52, 68
MluCI AATT 2 cut(s) 15, 124
MnlI CCTC 3 cut(s) 198, 210, 213
MseI TTAA 2 cut(s) 66, 122
MspR9I CCNGG 1 cut(s) 216
MvaI CCWGG 1 cut(s) 216
NdeII GATC 1 cut(s) 87
NlaIII CATG 3 cut(s) 64, 211, 238
NlaIV GGNNCC 2 cut(s) 73, 165
NmuCI GTSAC 2 cut(s) 104, 229
PfeI GAWTC 1 cut(s) 211
Psp6I CCWGG 1 cut(s) 214
PspEI GGTNACC 2 cut(s) 104, 229
PspGI CCWGG 1 cut(s) 214
PspN4I GGNNCC 2 cut(s) 73, 165
PspPI GGNCC 1 cut(s) 72
SaqAI TTAA 2 cut(s) 66, 122
Sau3AI GATC 1 cut(s) 87
Sau96I GGNCC 1 cut(s) 72
ScrFI CCNGG 1 cut(s) 216
SetI ASST 5 cut(s) 9, 111, 119, 169, 190
Sse9I AATT 2 cut(s) 15, 124
StyD4I CCNGG 1 cut(s) 214
TasI AATT 2 cut(s) 15, 124
TfiI GAWTC 1 cut(s) 211
Tru1I TTAA 2 cut(s) 66, 122
Tru9I TTAA 2 cut(s) 66, 122
TseFI GTSAC 2 cut(s) 104, 229
Tsp45I GTSAC 2 cut(s) 104, 229
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.