Rh3CG352500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
42619833 .. 42620627
795 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG352500.1

Sequence Viewer

Length: 192 bp
ATGGAATTGAGTATGTTAGTTTCAGTTCTAGACTTGAGATTGCTGAAAATGAAGAGGCAAATGGAGAAATCTAAGTCATGTGGTACAAGTTCTGCCTCAGCCCCGAAGAATAAATCATCTTCATCATCTCAGCCAAACATGAGTATCGAAGAATACCATTCTAACATGTGCAGAAGTTTAACAAATACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.0

Weight (kDa)

9.44

Isoelectric Point (pI)

81.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 85
AflIII ACRYGT 1 cut(s) 165
BaeI ACNNNNGTAYC 2 cut(s) 127, 160
BbvCI CCTCAGC 1 cut(s) 97
BfaI CTAG 1 cut(s) 29
Bpu10I CCTNAGC 1 cut(s) 97
BpuEI CTTGAG 1 cut(s) 55
BseMII CTCAG 2 cut(s) 111, 143
BsgI GTGCAG 1 cut(s) 190
BspCNI CTCAG 2 cut(s) 110, 142
Bst6I CTCTTC 1 cut(s) 47
BstDEI CTNAG 3 cut(s) 72, 97, 129
BstNSI RCATGY 1 cut(s) 169
Csp6I GTAC 1 cut(s) 84
CviAII CATG 3 cut(s) 78, 139, 166
CviJI RGCY 2 cut(s) 101, 133
CviKI_1 RGCY 2 cut(s) 101, 133
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 3 cut(s) 72, 97, 129
Eam1104I CTCTTC 1 cut(s) 47
EarI CTCTTC 1 cut(s) 47
FaeI CATG 3 cut(s) 81, 142, 169
FaiI YATR 4 cut(s) 14, 79, 140, 167
FatI CATG 3 cut(s) 77, 138, 165
FspBI CTAG 1 cut(s) 29
FspEI CC 9 cut(s) 40, 47, 66, 109, 115, 116, 117, 147, 170
Hin1II CATG 3 cut(s) 81, 142, 169
Hpy188III TCNNGA 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 171
HpyF3I CTNAG 3 cut(s) 72, 97, 129
Hsp92II CATG 3 cut(s) 81, 142, 169
MaeI CTAG 1 cut(s) 29
MboII GAAGA 4 cut(s) 64, 111, 118, 161
MluCI AATT 1 cut(s) 5
MnlI CCTC 2 cut(s) 48, 106
MseI TTAA 1 cut(s) 179
NlaIII CATG 3 cut(s) 81, 142, 169
NspI RCATGY 1 cut(s) 169
PciI ACATGT 1 cut(s) 165
PscI ACATGT 1 cut(s) 165
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SaqAI TTAA 1 cut(s) 179
SetI ASST 1 cut(s) 191
SgeI CNNG 7 cut(s) 41, 46, 90, 99, 115, 151, 178
SmlI CTYRAG 1 cut(s) 34
SmoI CTYRAG 1 cut(s) 34
Sse9I AATT 1 cut(s) 5
SspMI CTAG 1 cut(s) 29
TaqI TCGA 1 cut(s) 147
TasI AATT 1 cut(s) 5
Tru1I TTAA 1 cut(s) 179
Tru9I TTAA 1 cut(s) 179
TspDTI ATGAA 2 cut(s) 65, 111
XbaI TCTAGA 1 cut(s) 28
XceI RCATGY 1 cut(s) 169
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.