Rh6AG046400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
6764961 .. 6765134
174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG046400.1

Sequence Viewer

Length: 174 bp
ATGCATGACGTGATCTACATGACTCCGGCTCTTCGACGAGGCCCTCCACCACCAATATCGCCTCTTCCTCGGCCTCACCTACATCCCGTGACAACGACAAGGCCCTCGGCTTCTTCATCCCCAATCGAAAATCCCAACCGGAAAGTCTCTCCGGCTCTTCGAGATGGCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.23

Weight (kDa)

11.34

Isoelectric Point (pI)

108.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjiI CACGTC 1 cut(s) 10
Alw26I GTCTC 1 cut(s) 151
AoxI GGCC 4 cut(s) 40, 71, 101, 166
AspS9I GGNCC 2 cut(s) 41, 102
AsuHPI GGTGA 1 cut(s) 68
BccI CCATC 1 cut(s) 158
BcoDI GTCTC 1 cut(s) 151
BfmI CTRYAG 1 cut(s) 170
BmgBI CACGTC 1 cut(s) 10
BmgT120I GGNCC 2 cut(s) 41, 102
BsaJI CCNNGG 2 cut(s) 68, 105
BsaWI WCCGGW 1 cut(s) 138
BseDI CCNNGG 2 cut(s) 68, 105
BseGI GGATG 2 cut(s) 82, 116
BshFI GGCC 4 cut(s) 42, 73, 103, 168
BsiSI CCGG 3 cut(s) 26, 139, 152
BsmAI GTCTC 1 cut(s) 151
BsnI GGCC 4 cut(s) 42, 73, 103, 168
Bsp143I GATC 1 cut(s) 12
BspANI GGCC 4 cut(s) 42, 73, 103, 168
BspQI GCTCTTC 2 cut(s) 36, 162
BssECI CCNNGG 2 cut(s) 68, 105
BssMI GATC 1 cut(s) 12
Bst6I CTCTTC 3 cut(s) 36, 69, 162
BstF5I GGATG 2 cut(s) 82, 116
BstKTI GATC 1 cut(s) 15
BstMAI GTCTC 1 cut(s) 151
BstMBI GATC 1 cut(s) 12
BstSFI CTRYAG 1 cut(s) 170
BsuRI GGCC 4 cut(s) 42, 73, 103, 168
BtrI CACGTC 1 cut(s) 10
BtsCI GGATG 2 cut(s) 82, 116
Cfr13I GGNCC 2 cut(s) 41, 102
CviAII CATG 2 cut(s) 5, 19
CviJI RGCY 7 cut(s) 29, 42, 73, 103, 110, 155, 168
CviKI_1 RGCY 7 cut(s) 29, 42, 73, 103, 110, 155, 168
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
Eam1104I CTCTTC 3 cut(s) 36, 69, 162
EarI CTCTTC 3 cut(s) 36, 69, 162
EcoO109I RGGNCCY 2 cut(s) 41, 102
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 22
FaiI YATR 3 cut(s) 6, 20, 172
FatI CATG 2 cut(s) 4, 18
FokI GGATG 2 cut(s) 69, 103
HaeIII GGCC 4 cut(s) 42, 73, 103, 168
HapII CCGG 3 cut(s) 26, 139, 152
Hin1II CATG 2 cut(s) 8, 22
HinfI GANTC 1 cut(s) 22
HpaII CCGG 3 cut(s) 26, 139, 152
HphI GGTGA 1 cut(s) 68
Hpy188III TCNNGA 1 cut(s) 161
Hpy99I CGWCG 1 cut(s) 39
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 1 cut(s) 4
HpySE526I ACGT 1 cut(s) 9
Hsp92II CATG 2 cut(s) 8, 22
Kzo9I GATC 1 cut(s) 12
LguI GCTCTTC 2 cut(s) 36, 162
LpnPI CCDG 3 cut(s) 39, 152, 165
MaeII ACGT 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 88
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MboII GAAGA 4 cut(s) 23, 56, 105, 149
MlyI GAGTC 1 cut(s) 16
MnlI CCTC 6 cut(s) 32, 54, 72, 78, 84, 115
Mph1103I ATGCAT 1 cut(s) 6
MspI CCGG 3 cut(s) 26, 139, 152
NdeII GATC 1 cut(s) 12
NlaIII CATG 2 cut(s) 8, 22
NmeAIII GCCGAG 2 cut(s) 49, 86
NmuCI GTSAC 1 cut(s) 88
NsiI ATGCAT 1 cut(s) 6
PciSI GCTCTTC 2 cut(s) 36, 162
PleI GAGTC 1 cut(s) 16
PpsI GAGTC 1 cut(s) 16
PspPI GGNCC 2 cut(s) 41, 102
SapI GCTCTTC 2 cut(s) 36, 162
Sau3AI GATC 1 cut(s) 12
Sau96I GGNCC 2 cut(s) 41, 102
SchI GAGTC 1 cut(s) 16
SetI ASST 2 cut(s) 12, 81
SfcI CTRYAG 1 cut(s) 170
TaiI ACGT 1 cut(s) 12
TaqI TCGA 3 cut(s) 34, 126, 160
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 1 cut(s) 105
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.