Rh3DG021600

serine threonine protein phosphatase 2A regulatory subunit B''delta

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
1385895 .. 1388032
2138 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG021600.1

Sequence Viewer

Length: 183 bp
ATGGAGTGCATGGCCCAAGAACTTGTTCTCTTTGAAGATATATTGTGCCAGATTATTGACGTGATTTGCCCAGAGAAACGTGAGACTTGGACAGAGTGGCATCGGTTTGCATATAGAGAATATATTAGGCTTTCAATGGAAGAAGATGTTGAAGATGCTTCCAATGGAAGTGCAGAAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

7.2

Weight (kDa)

4.21

Isoelectric Point (pI)

56.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 35, 135, 152
AjiI CACGTC 1 cut(s) 61
AjuI GAANNNNNNNTTGG 2 cut(s) 9, 41
Alw26I GTCTC 1 cut(s) 77
AoxI GGCC 1 cut(s) 12
Asp700I GAANNNNTTC 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 13
BcoDI GTCTC 1 cut(s) 77
BmgBI CACGTC 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 13
BmsI GCATC 2 cut(s) 109, 145
BshFI GGCC 1 cut(s) 14
BsmAI GTCTC 1 cut(s) 77
BsnI GGCC 1 cut(s) 14
BspANI GGCC 1 cut(s) 14
BstMAI GTCTC 1 cut(s) 77
BsuRI GGCC 1 cut(s) 14
BtrI CACGTC 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 13
CviAII CATG 1 cut(s) 10
CviJI RGCY 2 cut(s) 14, 130
CviKI_1 RGCY 2 cut(s) 14, 130
FaeI CATG 1 cut(s) 13
FaiI YATR 5 cut(s) 11, 41, 112, 114, 123
FatI CATG 1 cut(s) 9
HaeIII GGCC 1 cut(s) 14
Hin1II CATG 1 cut(s) 13
HpyCH4IV ACGT 2 cut(s) 60, 79
HpyCH4V TGCA 3 cut(s) 9, 110, 173
HpySE526I ACGT 2 cut(s) 60, 79
Hsp92II CATG 1 cut(s) 13
LpnPI CCDG 2 cut(s) 62, 84
LweI GCATC 2 cut(s) 109, 145
MaeII ACGT 2 cut(s) 60, 79
MboII GAAGA 4 cut(s) 47, 152, 155, 164
MroXI GAANNNNTTC 1 cut(s) 24
NlaIII CATG 1 cut(s) 13
PdmI GAANNNNTTC 1 cut(s) 24
PspPI GGNCC 1 cut(s) 13
Sau96I GGNCC 1 cut(s) 13
SetI ASST 2 cut(s) 63, 82
SfaNI GCATC 2 cut(s) 109, 145
SgeI CNNG 8 cut(s) 22, 29, 35, 61, 73, 83, 92, 99
TaiI ACGT 2 cut(s) 63, 82
XmnI GAANNNNTTC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.