Rh3DG303100

Plasma membrane ATPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0016471
Physical Location & Seq
Forward (+)
32033212 .. 32043074
9863 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG303100.1

Sequence Viewer

Length: 435 bp
ATGGAAGCAACTCCAACTGTTGAGGCTGAGATCGAAGTGGCTAGAGTGCCTATTGTGTTGGGGGAATTGGACATTGTCAAGCCAACTCCAGCTACAGAAGTGCAGGTGAAGGCTTCTCTTTTGATCCTTACGCAAACTGTAGACTCCAGTGATAGCGTACATCCAGGCTTCCAAAGGTTGGTCATTAAGACTAAAGCCCACTCTTCAAGCTCCGCATCAACTCCAGTGTTGTCAGCAGTAGCTCGTTCTATTATGTTCTTGGGTGGCTTGAGTTCTCTGAATTTGTGCGTGTATCAGATTGGGAGGTGGATTGAGGAGGATGCTTCCGTTCTTGTTCCTGCTGATATAAATCATATAATCAACATTAAGTTTGGGGTTATTATTCCAGCACATGCTTGTCTCCTCGATGGTGATCCACTGAAATTGATCAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 map00190
Pfam Domains
Protein Families
Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

144

Amino Acids

15.39

Weight (kDa)

5.47

Isoelectric Point (pI)

49.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 94
Acc36I ACCTGC 1 cut(s) 94
AccB7I CCANNNNNTGG 1 cut(s) 178
AccI GTMKAC 1 cut(s) 141
AciI CCGC 1 cut(s) 213
AclWI GGATC 2 cut(s) 118, 407
AcsI RAATTY 1 cut(s) 280
AfaI GTAC 1 cut(s) 159
AfiI CCNNNNNNNGG 1 cut(s) 178
AgsI TTSAA 1 cut(s) 207
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 3 cut(s) 92, 210, 242
AluI AGCT 3 cut(s) 92, 210, 242
Alw26I GTCTC 1 cut(s) 404
AlwI GGATC 2 cut(s) 118, 407
ApoI RAATTY 1 cut(s) 280
AsuHPI GGTGA 2 cut(s) 118, 422
BccI CCATC 1 cut(s) 401
BciT130I CCWGG 1 cut(s) 165
BclI TGATCA 1 cut(s) 426
BcoDI GTCTC 1 cut(s) 404
BfaI CTAG 1 cut(s) 42
BfmI CTRYAG 2 cut(s) 93, 138
BfuAI ACCTGC 1 cut(s) 94
Bme1390I CCNGG 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 165
BmsI GCATC 2 cut(s) 224, 310
BpmI CTGGAG 3 cut(s) 72, 130, 207
BpuEI CTTGAG 1 cut(s) 289
BsaBI GATNNNNATC 2 cut(s) 348, 411
Bsc4I CCNNNNNNNGG 1 cut(s) 178
Bse1I ACTGG 2 cut(s) 147, 224
Bse8I GATNNNNATC 2 cut(s) 348, 411
BseBI CCWGG 1 cut(s) 165
BseGI GGATG 2 cut(s) 160, 325
BseJI GATNNNNATC 2 cut(s) 348, 411
BseLI CCNNNNNNNGG 1 cut(s) 178
BseMII CTCAG 1 cut(s) 18
BseNI ACTGG 2 cut(s) 147, 224
BseRI GAGGAG 2 cut(s) 329, 392
BsgI GTGCAG 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 404
Bsp143I GATC 4 cut(s) 30, 123, 412, 426
BspACI CCGC 1 cut(s) 213
BspCNI CTCAG 1 cut(s) 19
BspMI ACCTGC 1 cut(s) 94
BspPI GGATC 2 cut(s) 118, 407
BsrI ACTGG 2 cut(s) 147, 224
BssMI GATC 4 cut(s) 30, 123, 412, 426
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 2 cut(s) 19, 139
Bst6I CTCTTC 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 27
BstF5I GGATG 2 cut(s) 160, 325
BstKTI GATC 4 cut(s) 33, 126, 415, 429
BstMAI GTCTC 1 cut(s) 404
BstMBI GATC 4 cut(s) 30, 123, 412, 426
BstNI CCWGG 1 cut(s) 165
BstNSI RCATGY 1 cut(s) 395
BstSCI CCNGG 1 cut(s) 163
BstSFI CTRYAG 2 cut(s) 93, 138
BtsCI GGATG 2 cut(s) 160, 325
BtsIMutI CAGTG 3 cut(s) 154, 231, 416
BveI ACCTGC 1 cut(s) 94
Csp6I GTAC 1 cut(s) 158
CspCI CAANNNNNGTGG 1 cut(s) 405
CviAII CATG 1 cut(s) 392
CviQI GTAC 1 cut(s) 158
DdeI CTNAG 1 cut(s) 27
DpnI GATC 4 cut(s) 32, 125, 414, 428
DpnII GATC 4 cut(s) 30, 123, 412, 426
Eam1104I CTCTTC 1 cut(s) 208
EarI CTCTTC 1 cut(s) 208
EcoRII CCWGG 1 cut(s) 163
FaeI CATG 1 cut(s) 395
FaiI YATR 5 cut(s) 254, 347, 354, 356, 393
FatI CATG 1 cut(s) 391
FbaI TGATCA 1 cut(s) 426
FblI GTMKAC 1 cut(s) 141
FokI GGATG 2 cut(s) 147, 332
FspBI CTAG 1 cut(s) 42
GsuI CTGGAG 3 cut(s) 72, 130, 207
Hin1II CATG 1 cut(s) 395
HinfI GANTC 1 cut(s) 143
HphI GGTGA 2 cut(s) 118, 422
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 279, 297
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 2 cut(s) 19, 139
HpyCH4V TGCA 1 cut(s) 103
HpyF3I CTNAG 1 cut(s) 27
Hsp92II CATG 1 cut(s) 395
Ksp22I TGATCA 1 cut(s) 426
Kzo9I GATC 4 cut(s) 30, 123, 412, 426
LmnI GCTCC 1 cut(s) 215
LpnPI CCDG 9 cut(s) 89, 102, 150, 160, 177, 237, 351, 399, 415
LweI GCATC 2 cut(s) 224, 310
MaeI CTAG 1 cut(s) 42
MalI GATC 4 cut(s) 32, 125, 414, 428
MboI GATC 4 cut(s) 30, 123, 412, 426
MboII GAAGA 1 cut(s) 195
MluCI AATT 3 cut(s) 65, 280, 422
MlyI GAGTC 1 cut(s) 137
MmeI TCCRAC 1 cut(s) 38
MnlI CCTC 5 cut(s) 16, 297, 307, 310, 413
MseI TTAA 2 cut(s) 186, 366
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
NdeII GATC 4 cut(s) 30, 123, 412, 426
NlaIII CATG 1 cut(s) 395
NspI RCATGY 1 cut(s) 395
PaqCI CACCTGC 1 cut(s) 94
PflFI GACNNNGTC 1 cut(s) 74
PflMI CCANNNNNTGG 1 cut(s) 178
PleI GAGTC 1 cut(s) 137
PpsI GAGTC 1 cut(s) 137
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
PsyI GACNNNGTC 1 cut(s) 74
RsaI GTAC 1 cut(s) 159
RsaNI GTAC 1 cut(s) 158
SaqAI TTAA 2 cut(s) 186, 366
Sau3AI GATC 4 cut(s) 30, 123, 412, 426
SchI GAGTC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 165
SetI ASST 7 cut(s) 94, 108, 179, 212, 244, 308, 434
SfaNI GCATC 2 cut(s) 224, 310
SfcI CTRYAG 2 cut(s) 93, 138
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
Sse9I AATT 3 cut(s) 65, 280, 422
SsiI CCGC 1 cut(s) 213
SspMI CTAG 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 163
TaaI ACNGT 2 cut(s) 19, 139
TaqI TCGA 2 cut(s) 33, 405
TasI AATT 3 cut(s) 65, 280, 422
Tru1I TTAA 2 cut(s) 186, 366
Tru9I TTAA 2 cut(s) 186, 366
TscAI CASTG 3 cut(s) 154, 231, 423
TspGWI ACGGA 1 cut(s) 316
TspRI CASTG 3 cut(s) 154, 231, 423
Tth111I GACNNNGTC 1 cut(s) 74
Van91I CCANNNNNTGG 1 cut(s) 178
XapI RAATTY 1 cut(s) 280
XceI RCATGY 1 cut(s) 395
XmiI GTMKAC 1 cut(s) 141
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.