Rh4AG076500

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
15552893 .. 15554863
1971 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG076500.1

Sequence Viewer

Length: 285 bp
ATGCTCGTGACCATTGTGTATCCTCTTGGCTATCAAAGACCTCTTACGGAGAAGGATATATGGAAATTGGATACTTGGGATCAGGCTAAAACGCTGAGCAATAAGTTCCAAAAATGTTGGGCTGATGAAAACCGAAAGCCTAAACCATGGCTCTTGATAGCCTTAAACTGTAGCCTTGGGGGAAGGTTCTGCTGGGGAGGCTTTTGGAAGGTTGATGCTACAAATCGTGGAGGAATTGCTAGATTCATAAACCATTCTTGTGAGAGAGAAAGCCAAGAGCTATAG

Protein Analysis

94

Amino Acids

10.99

Weight (kDa)

9.02

Isoelectric Point (pI)

18.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 87
AluBI AGCT 1 cut(s) 280
AluI AGCT 1 cut(s) 280
AlwI GGATC 1 cut(s) 87
BauI CACGAG 1 cut(s) 5
BciVI GTATCC 2 cut(s) 30, 64
BfaI CTAG 1 cut(s) 240
BfmI CTRYAG 2 cut(s) 169, 281
BfuI GTATCC 2 cut(s) 30, 64
BlpI GCTNAGC 1 cut(s) 95
BmsI GCATC 1 cut(s) 205
Bpu1102I GCTNAGC 1 cut(s) 95
BsaJI CCNNGG 2 cut(s) 146, 175
BseDI CCNNGG 2 cut(s) 146, 175
BseMII CTCAG 1 cut(s) 86
BseYI CCCAGC 1 cut(s) 192
Bsp143I GATC 1 cut(s) 79
Bsp1720I GCTNAGC 1 cut(s) 95
Bsp19I CCATGG 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 87
BspPI GGATC 1 cut(s) 87
BssECI CCNNGG 2 cut(s) 146, 175
BssMI GATC 1 cut(s) 79
BssSI CACGAG 1 cut(s) 5
BssT1I CCWWGG 2 cut(s) 146, 175
Bst2BI CACGAG 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 95
BstDSI CCRYGG 1 cut(s) 146
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 198
BstSFI CTRYAG 2 cut(s) 169, 281
BsuI GTATCC 2 cut(s) 30, 64
BtgI CCRYGG 1 cut(s) 146
CviAII CATG 1 cut(s) 147
DdeI CTNAG 1 cut(s) 95
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eco130I CCWWGG 2 cut(s) 146, 175
EcoT14I CCWWGG 2 cut(s) 146, 175
ErhI CCWWGG 2 cut(s) 146, 175
FaeI CATG 1 cut(s) 150
FaiI YATR 5 cut(s) 59, 61, 148, 248, 283
FatI CATG 1 cut(s) 146
FspBI CTAG 1 cut(s) 240
GsaI CCCAGC 1 cut(s) 196
Hin1II CATG 1 cut(s) 150
HinfI GANTC 1 cut(s) 243
Hpy188III TCNNGA 2 cut(s) 7, 154
HpyAV CCTTC 3 cut(s) 46, 177, 202
HpyCH4III ACNGT 1 cut(s) 170
HpyF10VI GCNNNNNNNGC 1 cut(s) 198
HpyF3I CTNAG 1 cut(s) 95
Hsp92II CATG 1 cut(s) 150
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 68, 178
LweI GCATC 1 cut(s) 205
MaeI CTAG 1 cut(s) 240
MaeIII GTNAC 1 cut(s) 7
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MluCI AATT 2 cut(s) 65, 234
MnlI CCTC 4 cut(s) 33, 51, 191, 224
MseI TTAA 1 cut(s) 164
MslI CAYNNNNRTG 1 cut(s) 258
MwoI GCNNNNNNNGC 1 cut(s) 198
NcoI CCATGG 1 cut(s) 146
NdeII GATC 1 cut(s) 79
NlaIII CATG 1 cut(s) 150
NmuCI GTSAC 1 cut(s) 7
PfeI GAWTC 1 cut(s) 243
PspFI CCCAGC 1 cut(s) 192
RseI CAYNNNNRTG 1 cut(s) 258
SaqAI TTAA 1 cut(s) 164
Sau3AI GATC 1 cut(s) 79
SetI ASST 4 cut(s) 43, 188, 213, 282
SfaNI GCATC 1 cut(s) 205
SfcI CTRYAG 2 cut(s) 169, 281
SmiMI CAYNNNNRTG 1 cut(s) 258
Sse9I AATT 2 cut(s) 65, 234
SspMI CTAG 1 cut(s) 240
StyI CCWWGG 2 cut(s) 146, 175
TaaI ACNGT 1 cut(s) 170
TasI AATT 2 cut(s) 65, 234
TfiI GAWTC 1 cut(s) 243
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TseFI GTSAC 1 cut(s) 7
Tsp45I GTSAC 1 cut(s) 7
TspDTI ATGAA 2 cut(s) 141, 235
TspGWI ACGGA 1 cut(s) 62
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.